what is the meaning of biography in hausa language

Columbia University Libraries

Hausa language and culture acquisitions at columbia: biography, culture, history, proverbs, religion, and society.

Grammars, Phrasebooks, and Textbooks
Linguistics
Drama, Folktales, Novellas, Novels, Poetry, Readers, and Short Stories
Biography, Culture, History, Proverbs, Religion, and Society
Related Works in Arabic, English, French, and German

Biography, Culture, History, Proverbs, Religion, & Society

Abba, Abdullahi. Tarihin Bauchi ta Yakubu . Zaria [Nigeria] : Gaskiya Corp., 1993. (71 p.) [In Hausa, a history of the Bauchi kings since the 19th century.]
ʻAbd Allāh ibn Muḥammad. Jagorar shugabanci a musulunci da warwarar wasu matsaloli na addini : talifin Shehu Abdullahi Dan Fodiyo . Kano [Nigeria] : Cibiyar Nazarin Harsunan Nijeriya, [1992]. (138 p.) [Early 19th century Hausa work on Islamic leadership by emir of Gwandu, brother of Uthman dan Fodio, founder of the Sokoto Caliphate.]
ʻAbd Allāh ibn Muḥammad. Littafin kitabun-niyyati fil a'malid-dunyawiyyati wad-di'niyyati . [Edited and comments by] Muhammad Isa Talata-Mafara. [Nigeria : s.n.], [1992] (60 p.) [Selected writings of early 19th century emir of Gwandu, brother of Uthman dan Fodio, founder of the Sokoto Caliphate.]
ʻAbd Allāh ibn Muḥammad, Emir of Gwandu, c1767-1829. Zaɓaɓɓun littattaffai na Shehu Abdullahi Ɗan Fodiyo . 3 vols. Samaru, Gusau : Iqra'ah Publishing House, [2013] --See also: English translation
Abdulkadir, Dandatti. The poetry, life, and opinions of Saʾadu Zungur . Zaria : Northern Nigerian Pub. Co., 1974. (109 p.) [English & Hausa] --See also: Zungur, Sa'adu below.
Abdullahi, Shehu Umar. Gaskiya dokin k̳arfe . Kano, Nigeria : Mai-Nasara Printing, 1985. (127 p.) [In Hausa, essays on Hausa culture, Islam, social change, politics, & development in Nigeria under colonialism and in the post-colonial era.]
Abubakar, Alhaji. Kano ta dabo cigari . Zaria: Northern Nigerian Publishing Co., 1978. (105 p.) [In Hausa, a history of Kano.]
Abubakar Gidado El-Nafaty. Tarihin Islam . Zaria: Northern Nigerian Publishing Company, 1977 (1979 printing). (259 p.) [In Hausa, a history of Islam.]
Abubakar, Mohammed N. and Alhasan Sule. Tarihin rayuwar Dr. Alhaji Mamman Shata . [Kano : s.n., 1998?] (78 p.) [Biography.]
Abubuwan da za a yi a taki na karshe : abin da ya kamata ka sani. [Nigeria] : National Electoral Commission, [1992 or 1993] (20 p.) [A voter and election monitoring guide.]
Adewuya, Anthonia V., Malam Abubakar, Ahmadu Yaro, and Garba Umar Suru. Hanyar zaman iyali : tattalin gida domin yara maza da mata a makarantun Firamaren Nijeriya : littafi na uku . Ibadan, Nigeria : Onibonoje Press, 1988. (31 p.) [In Hausa, on nutrition, cleanliness, & preventive health.]
Ahmed, Abubakar Sadiq. Tarihin rayuwar Alhaji Nababa Badamasi . Nigeria: Uniprinters Limited, [199-?] (68 p.) [Biography]
Anwar, Auwalu. Tasirin siyasa a addini : tijjanawa da tirjanawa a Kano, 1937-1991 . [Zaria, Nigeria] : Stronglink, c1992. (61 p.) [In Hausa, on the political history of Tijani Muslims in 20th century Kano.]
Asma'u, Nana. Collected works of Nana Asma'u, daughter of Usman dan Fodiyo, (1793-1864). [Edited by Jean Boyd and Beverly B. Mack.] African historical sources; no. 9 . East Lansing, MI: Michigan State University Press, [1997] (753 p.) [English analysis, with Hausa texts & English translations.] --See also: E-book [Columbia only!]
Baagil, Hasan M. Muslim-Christian dialogue = Muhawara tsakanin Musulmi da Krista [na Muhammad Bin Uthman.] Kano : [s.n.], 1999. (112 p.) [Mostly in Hausa.]
Baba, of Karo. Labarin Baba: mutuniyar Karo ta kasar Kano . Transcribed and translated by Mary Smith ta rubuta; ta tsara da taimakon Neil Skinner. Madison, Wis.: African Studies Program, University of Wisconsin-Madison, c1993. (89 p.; originally published in English in 1954) [An autobiographical account in Hausa, with sociological insights.] --See also: 1981 English ed. ; Law Library copy of 1981 ed. --Plus: 1964 English ed . --Plus: 1955 English ed. --And: 1954 English ed. ; Burke Library copy of 1954 ed.
Bahago, Ahmad. Kano ta dabo tumbin giwa: tarihin unguwannin Kano da mazaunanta da ganuwa da kofofin Gari . Kano: Munawwar Books Foundation, 1998. (237 p.) [In Hausa, a history of Kano.]
Bahaushiya : bukin makon Hausa na farko na Kungiyar Habaka Hausa, Jamiʾar Ahmadu Bello ta Zariya . [Zaria, Nigeria : Ahmadu Bello University, 1986?] (223 p.) [In Hausa, selected proceedings from a conference held at Ahmadu Bello University in March 1985 on Hausa language, literature & culture, including several poetic texts.]
Bello, Muḥammad, Sultan of Sokoto, 1781-1837. Zaɓaɓɓun littattaffai na Sarkin Musulmi Muhammadu Bello . 2 vols. Samaru, Gusau : Iqra'ah Publishing House, [2013] --See also: English translation
Bello, Omar. Jaddada addini a kasar Hausa : jihadin Shaykh Uthman b. Foduye . [Sokoto] : Islamic Academy, [1994] (23 p.) [In Hausa, on the jihad of Uthman dan Fodio, founder of the Sokoto Caliphate.]
Burji, Badamasi Shu'aibu G. Gaskiya nagartar namiji : tarihin rayuwar Janar Hassan Usman Katsina Kano : Burji Publishers, 1997. (462 p.) [Biography{
Dahiru, Muhammad Sanusi. Laifin wa? . Katsina : Na-Hamisu Press, 1996. (54 p.) [On Hausa culture.]
Dalhat, M. T. Ilimin jima'i a musulunci . Kaduna : Alkausar Print. and Pub. Co., 1993. (73 p.) [In Hausa, about sexual relations in Islam.]
Daure, Buhari. Tarihi da al'adun mutanen Najeriya . [Katsina? : s.n., 1998?] (90 p.) [Nigerian history]
Dodo, Aishatu Nurudeen. Taran aradu da ka . Kaduna : Bamoya Printing Press, 1997. (35 p.) [In Hausa, on marriage.]
Durumin-Iya, Salisu Mai'Unguwa. Kissar Sarauniya Bilkisu : mai gadon zinare . Kano : [s.n.], 1998. (31 p.) [A pamphlet in Hausa, commentary on Islam.]
East, Rupert Moultrie and Alhaji Abubakar Imam. Ikon Allah: labarin halita iri iri ta cikin duniya . 5 vols. Zaria: Northern Nigerian Pub. Co., c1966 (1977 printing). [Natural history]
Fletcher, Roland S. Hausa sayings & folk-lore; with a vocabulary of new words . London; New York: Oxford University Press, 1912. (173 p.)
Gamagira, Sa'idu. Littafin mafarki . Zaria : Northern Nigerian Pub. Co., c1970- [In Hausa, about dreams; Columbia only has volume 1.]
Guibe, Is'haq Idris. Rayayyen nahawun larabci da ka'Idojinsa = al-Naḥw al-wā ḍiḥ fī qawā ʻid al-lughah al-ʻArabī yah . Kaduna: Kauran Wali Islamic Bookshop, 1998. [In Hausa, on the Arabic language ; Columbia has only volume 1.]
Gusau, Sa'idu Muhammad. Dabarun nazarin adabin hausa . Kaduna : Dab'in Fisbas Media Services, 1995. (72 p.) [On Hausa writers, works by colonial European writers on Hausa language & culture, & modern researchers (African & nonAfrican) & their contributions.]
Gusau, Sa'idu Muhammad. Jagorar nazarin wakar baka . Kaduna : Dab'in Fisbas Media Services, 1993. (81 p.) [A study of Hausa spoken language.]
Gusau, Sa'idu Muhammad. Madad̳a da mawakan Hausa . Kaduna : Fisbas Media Services, [1996] [Biographical sketches of Hausa rulers in the 20th century.]
Hakīm, Tawfīq. Mutanen kogo . Mai fassara Ahmed Sabir. Ibadan, Nigeria: Oxford University Press, c1976. (105 p.) [A dramatization in Hausa, based on the 18th sura in the Noble Quran, "The Cave".]
Hiskett, Mervyn. A history of Hausa Islamic verse . London : University of London, School of Oriental and African Studies, 1975. (274 p.)
Histoire du Dawra . [Traditions historiques du Dawra par Makada Ibira de Kantché ; transcription et traduction par Issaka Dankousso.] Niamey, Niger: Centre régional de documentation pour la tradition orale, 1970. (39 leaves.) [Hausa & French]
Imam, Tijani M. Hikayoyin Shehu Jaha . 2 vols. Kano : Baitul Hikmah, 1998. [Stories in Hausa about 13th century Seljuq Sufi philosopher in what is now Turkey, known for his satire.]
Jaggar, Philip J. Hausa newspaper reader . Kensington, Md.: Dunwoody, c1996. (225 p.)
Jahun, Lauya Suleiman Ibrahim. Sarkin kano : alu maisango . Kano : Alaramma Books Centre, c1986. (94 p.) [In Hausa, on the emir of Kano.]
Kano, Aminu. Rayuwar Ahmad Mahmud Sa'adu Zungur . Zaria: Northern Nigerian Pub. Co., 1973. (17 p.) [A short biography of Sa'sadu Zungur, Nigerian nationalist.]
Ka'oje, Abdullahi. Dare Daya : Allah kan yi Bature . Zaria : Northern Nigerian Publishing Company, 1973, reprint c1978. (71 p.)
Kirk-Greene, Anthony Hamilton Millard. (trans.) Hausa ba dabo ba ne; a collection of 500 proverbs . Translated and annotated by A. H. M. Kirk-Greene. Ibadan [Nigeria] Oxford University Press, 1966. (84 p.) [English & Hausa]
Kubau, Y.A. Shi, hijabi umarnin wane ne? . Kano : Garba Mohammed Bookshop, 1996. (20 p.) [A pamphlet on the religious & social meaning of the hijab.]
Kure, Mai Kudi. Shaida bishara ga Musulmi Hausawa da Fulani musamman : da yadda za a goyi Musulmi wanda ya tuba . [S.l. : s.n., c1990] (Jos [Nigeria] : Covenant Press) (35 p.) [In Hausa, about Christian converts among Muslim Hausa.]
Kwalli, Kabiru Mohammed. Kano Jalla babbar Hausa . [Kano? : s.n.], 1996. (313 p.) [In Hausa, a history of Kano.]
Labarun Hausawa da makwabtansu . 2 vols. Zaria: Northern Nigerian Pub. Co., 1970 (1979 printing). [In Hausa, on the political history of the Hausa and their neighbors.]
Littafin wakoki. Jos, Nigeria : Published for Christian Media Fellowship by Challenge Publications, 1982. (365 p.) [In Hausa translation, a book of Christian hymns.]
Maigari, Muhammad Tahir. Ilimin alkalanci na shari'a . Kano, Nigeria : Fairamma Publishing Co., 1991. [In Hausa, on Islamic law.]
Makarfi, Abdulkarim A. Garba. Sarkin Zazzau : Malam Ja'afaru 'Dan Is'hak . Zaria : Makarfi Publishing, 1990. (138 p.) [In Hausa, a profile of Ja'afaru 'Dan Is'hak, emir of Zazzau or Zaria.]
Malumfashi, Ibrahim. Asalin zuriyar galaduncin Katsina . [Kaduna: NNN, Commercial Printing Dept., 1990] (48 p.) [In Hausa, on the galadimas, rulers of Katsina.]
Merrick, George. Hausa proverbs . New York, Negro Universities Press [1969] (113 p.) [English & Hausa] --See also: 1905 ed.
Muhammad, Mahmoud Aliyu. Hanyoyin tsari daga kamuwa da cutar al-jannu da sihiri da rashin lafiya mai wuyar magani . Kano : Burji Publishers, [1998?] (20 p.)
Nafiou, Rabiou. La sagesse populaire haoussa en 300 proverbes et dictons : ou Kogin Hikima . Paris : L'Harmattan, [2014] (81 p.) [French & Hausa}
Nawawī. Hadisai Arbaʾin : = al-Arbaʻūn ḥadithan al-Nawawīyah . [Translated by] Alhaji Abubakar Mahmud Gumi. Zaria : The Northern Nigerian Publishing Co., 1982. (24 p.) [In Hausa translation, selected hadiths of 13th century Shafi'ite Imam Nawawi.]
Nuruddeen, Ibrahim. Fate-fate kan tona . Kano : Munawwar Books Foundation, 1997. (59 p.) [In Hausa, a memoir of Yusuf Halilu's experiences in 20th century London, England.]
Omoruyi, Omo. Taimakon Mallam Aminu Kano dangane da fahimtar da talaka siyasa a Nijeriya . Abuja : Cibiyar Nazarin Dimokaradiyya, 1992. (35 p.) [In Hausa, about Aminu Kano and his leadership role in the politics of the poor in Nigeria.]
Othman, Mairo Yusuf. Rikon gida sai mata . Kano : Masbel Press, [199-?]- [On home economics & crafts; Columbia only has volume 1.]
Pilaszewicz, Stanislaw. The Zabarma conquest of north-west Ghana and upper Volta: a Hausa narrative "Histories of Samory and Babatu and others" by Mallam Abu . Warsaw: Polish Scientific Publishers, 1992. (207 p.) [English commentary, with Hausa historical texts in Arabic script & transliteration.]
Prietze, Rudolf. Haussa-sprichwörter und Haussa-lieder . Kirchhain N.-L., Buchdruckerei von M. Schmersow, 1904. (85 p.) [In German & Hausa, collected & edited Hausa proverbs & songs.]
Rattray, Robert Sutherland (ed. & trans.) Hausa folk-lore, customs, proverbs, etc . 2 vols. Oxford : Clarendon Press, 1969. [Hausa texts, in Arabic script (or àjàmi), with Roman transliteration & English translation.] --See also: 1913 ed. ; Burke Library copy --Plus: E-book [Columbia only!]
Rayuwar Hausawa . [Compiled by] Cibiyar Nazarin Harsunan Nijeriya, Jamiʾar Bayero = Bayero University. Centre for the Study of Nigerian Languages. Lagos : Thomas Nelson (Nigeria) Ltd., 1981. (46 p.) [On Hausa history & culture.]
Ringim, Alhaji Ibrahim Bello. Salsalar ya'yan Abdullahi Maje Karofi da Jikokinsa . Kano : [s.n.], 1997. (66 p.) [In Hausa, a history of the Karofi family.]
Ringim, Maryam Uba. Me ke kawo mutuwar aure? Kano : Jihisa Secretaries, 1998. (74 p.)
Sani, Umar Mohammed. Tsabta da kare kai daga cuta . Zaria : Huda Huda Pub. Co., 1997- [In Hausa, a pamphlet on nutrition, cleanliness, & preventive health; Columbia only has volume 1.]
Schön, James Frederick. Magana Hausa : native literature, or proverbs, tales, fables and historical fragments in the Hausa language . [To which is added a translation in English.] 2 vols. Nendeln: Kraus Reprint, [1885-1886], reprint 1970. [In Hausa & English, a collection of proverbs, folktales, & life & travels of "Dorugu" accompanying Heinrich Barth in Africa, England, & Germany,] --See also: E-book [Columbia onlyl!]
Sharīf, Muḥammad Shākir. Illolin raba siyasa da addini : da hadarin kafirar gwamnati . [Edited by] Abdullahi Jibril Ahmed. [S.l.] : Atta'awun Pub., [1991?]. (25 p.) [In Hausa, on Islam & politics.]
Soron Dinki, Dahiru Umar. Ulama'u na Allah : tarihin Imam Abu Hanifa da kuma Imam Malik (R.A.) . Kano : Dahiru Umar Sorondinki, [1998?]- [In Hausa, a multi-volume work on Islam & biography of Abu Hanifa; Columbia only has volume 1.]
Sufi, Husaini Ahmad. Wali Sulaimanu a tarihin Kano . Kano : Mali-Nasara Press, [1993?]. (415 p.) [On the history of Kano, with biographical sketches of rulers & prominent persons.]
Suleiman, Amina Garba. Ciki da goyo ikon Allah . Kano: A-Z Printers, 1999- [In Hausa, a handbook for expectant & new mothers on nutrition, pre-natal, & post-natal care; Columbia library only has volume 1.]
Talata-Mafara, Muhammad Isa. Daular usmaniyya : rayuwar sheshu usman danfodiyo da gwagwarmayarsa : littafi na farko . Zaria : Hudahuda, 1419 [1999] (156 p.) [In Hausa, a biography of Usman dan Fodio, & on the political history of major cities & emirates in the Sokoto caliphate.]
Tarihi, Hukumar Binciken. Garuruwan Jihar Katsina . Na Hukumar Binciken Tarihi da Kyautata Al'adu ta jihar Katsina. 2 vols. [Katsina : s.n.], 1996- [In Hausa, on the kings & rulers of Katsina.]
Tarihin Sheikh Ibrahim Inyas (R.T.A.) : takaitaccan tarihin sheihul Islam, Assaiyidi Ibrahim Inyas Khaulaha Attijjaniyu (R.T.A.) wanda aka rairayo shi a cikin (Hayatus Sheikh) . [Kano? : s.n., 1998?] (35 p.) [A biography of Sheikh Ibrahim Niass of the Tijani sufi order.]
Tattalin albarkatun kasa : tarin takardun da aka gabatar a taron aikin gayya na farko kan tattalin albarkatun kasa wanda reshen jihar kano na kungiyar tattalin albarkatun kasa, ya gudanar . Tsantsamewa da tsarawar Abba Rufa'i. Kano, Nigeria : Bayero University, 1991. (93 p.) [In Hausa, on land use & environment in northern Nigeria.]
Tijjani, Safiya A. Aure dodon maza-- . [Kaduna? : s.n.], 1997. (46 p.) [In Hausa, a pamphlet on money & gender relations.]
Tremearne, Arthur John Newman. The Niger and the West Sudan; or, The West African's note book . A vade mecum containing hints and suggestions as to what is required by Britons in West Africa, together with historical and anthropological notes and easy Hausa phrases used in everyday conversation. London, Hodder & Stoughton [etc., pref. 1910] (151 p.)
Umaru, Alhaji. Hausa prose writings in Ajami by Alhaji Umaru ; from A. Mischlich . H. Sölken's collection ; Stanislaw Pilaszewicz. Sprache und Oralität in Afrika; 22. Bd . Berlin: Reimer, 2000. (507 p.) [Selections from 11 Hausa manuscripts written in the àjàmi script.]
Usuman dan Fodio, 1754-1817. Waṣīyat al-Shaykh ʻUthmān ibn Fūdī . al-nāshir, Manjū Muṣṭafá Jūkūlū ibn Amīr Ghawand al-Ḥājj Hārūn al-Rashīd. Zāriyā, Nījīriyā : Maṭbaʻat Ghasikiyā Kūfarīshin, [1989?] (48, 36 p.) [In Arabic & Hausa, the will & testament of the founder of the Sokoto Caliphate.]
Usuman dan Fodio, 1754-1817. Zaɓaɓɓun littattaffai na Shehu Usumanu Ɗan Fodiyo . 3 vols. Samaru, Gusau : Iqra'ah Publishing House, [2013] --See also: English translation
Wali, Naʼibi Sulaimanu. Duniya ina za ki da mu? [Zaria : Northern Nigeria Pub. Co.], 1974 (1979 printing) (60 p.) [On Hausa culture & morals.]
Westley, David. Hausa oral traditions: an annotated bibliography . Working papers in African studies ; no. 15. Boston, MA: African Studies Center, Boston University, c1991. (22 leaves)
Yahaya, Ibrahim Yaro. Hausa a rubuce : tarihin rubuce rubuce cikin Hausa . Zaria : Kamfanin Buga Littattafai Na Nigeria Ta Arewa, 1988. (344 p.) [A history of Hausa written literature.]
Yakasai, Kabiru Ibrahim. Kasuwa a kai miki dole : tarihin kasuwanni da ciniki a kasar Kano . [Nigeria] : K.I. Yakasai, 1994. (205 p.) [In Hausa, on the markets of Kano.]
Yunusa, Yusufu. Hausa a dunkule . Illustrations by Tsalhatu Amfani Joe. Zaria : Northern Nigerian Publishing Co., 1978. (120 p.) [Hausa proverbs.]
Ziyara, Nasiru Musa. Khalifa : Khalifa Shekh Ishaq Rabiu . Kano : Hakima Graphic, 1995. (220 p.) [Biography of Shekh Ishaq Rabiu of Kano.]
Zungur, Saʼadu. Saʾadu Zungur : an anthology of the social and political writings of a Nigerian nationalist . Edited by Alhaji Mahmood Yakubu. Kaduna, Nigeria : Nigerian Defence Academy Press, 1999. (453 p.) [English & Hausa}
<< Previous: Drama, Folktales, Novellas, Novels, Poetry, Readers, and Short Stories
Next: Related Works in Arabic, English, French, and German >>
Last Updated: Dec 20, 2023 11:08 AM
URL: https://guides.library.columbia.edu/hausa-language
Donate Books or Items
Suggestions & Feedback
Report an E-Resource Problem
The Bancroft Prizes
Student Library Advisory Committee
Jobs & Internships
Behind the Scenes at Columbia's Libraries

News in English
News in German
Press Releases in German
Imprint/Contact
Institutions
Prospective Students
Ph.D. Candidates
Researchers

Humboldt-Universität zu Berlin - Faculty of Humanities and Social Sciences - Department of African Studies

The hausa language.

Hausa is classified as a member of the Chadic branch of the Afro-Asiatic family of languages. It is the best known and most important member of the Chadic branch. It is the most widely used in the fields of education and it lays claim to a significant literatures. By way of number, it is spoken by an estimated 40 to 50 million people as a first and second language thus, it believed to be one of the most commonly spoken African languages.

Where is Hausa Spoken?

Most Hausa speakers live in Northern Nigeria and Southern Republic of Niger. In Nigeria, Hausa-speaking area encompasses the historical emirates of Kano, Katsina, Daura, Zaria and Gobir, all of which were incorporated into the Sokoto caliphate following the Fulani Jihad led by Usman Shehu Ɗanfodio in the early 19 th century. Hausa is also spoken in diaspora by traders, scholars and immigrants in urban areas of West Africa, for example, southern and central Nigeria, Benin Republic, Burkina Faso, Cameroon, Ghana, Togo as well as Chad and the Blue Nile Province and western region of the Sudan.

Hausa and its Dialects

Hausa has a number of geographical dialects, marked by differences in pronunciation and vocabulary. In some instances, one can notice the variation between eastern dialects on the one hand, e.g. Kano, and areas to the south (Zaria), southeast (Bauchi), with (Daura) and western dialects on the other, e.g Sokoto, Gobir, and northwards into Niger. Within eastern dialect, Standard Hausa is coined. It is based on “ Kananci ” the dialect of Kano, an enormous Hausa commercial centre located in Northern Nigeria. Standard Hausa has been recognised as the norm for the written language as contained in books and newspapers and also for broadcast in radio and television. This variety is used as Subject and Course as well as language of instruction in schools, colleges, universities including Humboldt University Berlin, Germany. It is pertinent to mention that Hausa language dialects are mutually intelligible.

Hausa Phonology and Language Structure

The phonemic inventory of Hausa consists of consonants and vowels. There are 34 consonants in Standard Hausa. The vowels are 13 comprising of 5 short vowels and 5 corresponding long vowels and 3 diphthongs.

In the inventory, some consonants are not found in English. Most common of these are the hooked letters, ɓ, ɗ, ƙ and the semi vowel `y, which are entirely different from the corresponding plain letters b, d, k and y.

/b/ barìi To leave/To stop

/ɓ/ ɓarìi Shivering

/d/ daidai Correct/Exact

/ɗ/ ɗaiɗai One by one

/k/ bàakii Mouth

/ƙ/ bàaƙii Guests

/y/ yaayaa? How?

/`y/ `yaa`yaa Children/Sons/Daughters/Fruits

In like manner, short and long vowels also show difference in meaning in some cases.

/a/ Tàfi To go/To travel/To walk

/aa/ Taafii Palm of hand/Sole of foot/Clap

The 3 diphthongs are: /ai/, /au/ and /ui/.

/ai/ Râi Life

Mài Possessor of, Doer of

/au/ Yâu Today

Yàushè? When?

/ui/ Guiwa Knee

Hausa is a tonal language. It has 3 tones:

3. Falling.

High tone is left unmarked. Low tone is indicated by a grave accent (`) while falling tone is a combination of high and low and is indicated by a circumflex (^). These tones are extremely important in distinguishing meanings and grammatical categories. For example,

Bàaba (LH) Father.

Baabà (HL) Mother.

Baabaa (HH) Indigo.

Dà (L) And/With.

Dâ (F) Formerly/Before

On language structure, Hausa sentences are basically in conformity with the Subject Verb Object (SVO) order. For example,

Markus yaa tàfi Nijeriya. Markus went to Nigeria.

Markus He.PST go Nijeriya.

Writing Systems in Hausa

Hausa has a literary tradition extending back several centuries before contact with Western culture. Hausa was first written in an Arabic script known as Ajami. Today, this representation of the language has been superseded for most purposes by the Roman script.

Adamu, M. 1978. The Hausa Factor in West African History. Ahmadu Bello University, Zaria, Press

Adamu, M. 1984. “The Hausa and their Neighbours in the Central Sudan”, In: General History of Africa. IV: Africa from the twelfth to the sixteenth century. D.T. Niane (ed), Californica: University of California Press

Cowan, Jr. and Russell, G. Schuh. 1976. Spoken Hausa, Ithace, NY: Spoken Language Services.

Charles H, Kraft and A:H:M: Kirk-Greene. 1973. Teach Yourself Hausa, London: The English University Press, Ltd.

Graham L. Furniss 1996. Poetry, prose and popular culture in Hausa, Edinburgh: Edinburgh University Press.

M.A.Z Sani. 1999. Tsarin Sauti Da Nahawun Hausa, University Press PLC Ibadan.

Yahaya Y. Ibrahim. 1988. Hausa a Rubuce: Tarihin Rubuce-rubuce Cikin Hausa, NNPC, Zaria.

HU on the internet

Humboldt University on Facebook
Die Humboldt-Universität bei BlueSky
Humboldt University on Instagram
Humboldt University on YouTube
Humboldt University on LinkedIn
RSS-Feeds of the Humboldt University
Humboldt University on Twitter

Browse : A - a - B - b - Ɓ - ɓ - C - c - D - d - Ɗ - ɗ - E - e - F - f - G - g - H - h - I - i - J - j - K - k - Ƙ - ƙ - L - l - M - m - N - n - O - o - P - p - Q - q - R - r - S - s - T - t - U - u - V - v - W - w - X - x - Y - y - Ƴ - ƴ - Z - z

Hello! <> Sannu!

HausaDictionary.com is an online bilingual dictionary that aims to offer the most useful and accurate Hausa to English or English to Hausa translations and definitions. This site contains a wide range of Hausa and English language materials and resources to help you learn Hausa or English. Pick up some basic terms and phrases here , expand your vocabulary, or find a language partner to practice with. Other ways to learn is through language immersion where you spend a good amount of time with the language you would like to learn through a combination of reading, listening , or watching Hausa content on YouTube , Arewa24 , or Hausa films . To learn more about HausaDictionary.com and its mission, click here .

what is the meaning of biography in hausa language

Glosbe Google Bing

• A Hausa-English dictionary by George Percy Bargery (1934) online search in the Bargery's dictionary

• Hausa dialect vocabulary , based on the Bargery's Hausa-English dictionary , by Shuji Matsushita (1993)

• Hausar baka : Hausa-English Vocabulary (1998)

• Zaar-English-Hausa dictionary by Bernard Caron

• Boston university : Hausa-English basic vocabulary (+ audio)

• Defense language institute : basic vocabulary (+ audio) - civil affairs - medical ( Defense Language Institute )

• Dictionary of the Hausa language by Charles Henry Robinson (1913)

• English-Hausa

• Vocabulary of the Haussa language by James Frederick Schön (1843)

• Essai de dictionnaire : Hausa-French dictionary, by Jean-Marie Le Roux (1886)

• Wörterbuch der Hausasprache : Hausa-German dictionary, by Adam Mischlich (1906) (Latin & Arabic scripts)

• studies about the Hausa language, by Nina Pawlak

• Woman and man in Hausa language and culture , in Hausa and Chadic studies (2014)

• The concept of "truth" ( gaskiya ) in Hausa, between oral and written tradition , in African Studies (2016)

• The conceptual structure of "coming" and "going" in Hausa (2010)

• Hausa names for plants and trees by Roger Blench (2007)

• Hausa names of some common birds (2003)

• The etymology of Hausa boko by Paul Newman (2013)

• The provenance of Arabic loanwords in Hausa : a phonological and semantic study , by Mohamed El-Shazly, thesis (1987)

• French loans in Hausa by Sergio Baldi, in Hausa and Chadic Studies (2014) NEW

• Hausa proverbs by George Merrick (1905)

→ Hausa keyboard to type a text with the special characters of the Boko script

• Teach yourself Hausa : Hausa course

• Hausa basic course , Foreign service institute (1963) (+ audio)

• Hausa online Lehrbuch : Hausa course, by Franz Stoiber (2002)

• Hausa by Al-Amin Abu-Manga, in Encyclopedia of Arabic language and linguistics (2007)

• Le haoussa by Bernard Caron, in Dictionnaire des langues (2011)

• Hausa in the twentieth century : an overview , by John Edward Philips, in Sudanic Africa (2004)

• linguistic studies about Hausa, by Bernard Caron

• Hausa, grammatical sketch (2011)

• The Hausa lexicographic tradition by Roxanna Ma Newman & Paul Newman, in Lexikos (2001)

• An introduction to the use of aspect in Hausa narrative by Donald Buquest (1992)

• Comparative study of morphological processes in English and Hausa languages by Zubairu Bitrus Samaila (2015)

• Hausa verbal compounds by Anthony McIntyre, thesis (2006)

• Introductory Hausa & Hausa-English vocabulary, by Charles & Marguerite Kraft (1973)

• Grammar of the Hausa language by Frederick Migeod (1914)

• Hausa Grammar with exercises, readings and vocabularies , by Charles Robinson & John Alder Burdon (1905)

• Hausa notes : grammar & vocabulary, by Walter Miller (1922)

• Grammar of the Hausa language by James Frederick Schön (1862)

• Manuel de langue haoussa : grammar, readings and Hausa-French vocabulary, by Maurice Delafosse (1901)

• Manuel pratique de langue haoussa : Hausa grammar, by Adolf Adirr (1895)

• Lehrbuch der Hausa-Sprache : Handbook of the Hausa language, by Adam Mischlich (1911)

• books about the Hausa language: Google books | Internet archive | Academia | Wikipedia

• Hausa online : resources about the Hausa language (blog)

• BBC - VOA - RFI - DW : news in Hausa

• Specimens of Hausa literature by Charles Henry Robinson (1896)

• Hausa reading book by Lionel Charlton (1908)

• Hausa folk-tales , the Hausa text of the stories in Hausa superstitions and customs , by Arthur Tremearne (1914)

• Hausa superstitions and customs , an introduction to the folk-lore and the folk , by Arthur Tremearne (1913)

• Hausa folk-lore, customs, proverbs … collected and transliterated with English translation and notes, by Robert Sutherland Rattray (1913): I & II

• Magana Hausa , Hausa stories and fables , collected by James Frederick Schön (1906)

• Hausa stories and riddles , with notes on the language & Hausa dictionary, by Hermann Harris (1908)

• Hausa popular literature and video film by Graham Furniss (2003)

• La-yia yekpe nanisia, wotenga Mende-bela ti Kenye-lei hu : The Gospels (1872)

• The Epistles and Revelations in Hausa (1879)

• Visionneuse : translation of the Bible into Hausa

• Tanzil : translation of the Quran into Hausa by Abubakar Mahmoud Gumi

Su dai ƴan-adam, ana haifuwarsu ne duka ƴantattu, kuma kowannensu na da mutunci da hakkoki daidai da na kowa. Suna da hankali da tunani, saboda haka duk abin da za su aikata wa juna, ya kamata su yi shi a cikin ƴan-uwanci.

• Universal Declaration of Human Rights : translation into Hausa (+ audio)

→ First article in different languages

→ Universal Declaration of Human Rights : bilingual text in Hausa, English…

→ languages of Africa

→ Nigeria - Niger

→ Africa

Subject List
Take a Tour
For Authors
Subscriber Services
Publications
African American Studies

African Studies

American Literature
Anthropology
Architecture Planning and Preservation
Art History
Atlantic History
Biblical Studies
British and Irish Literature
Childhood Studies
Chinese Studies
Cinema and Media Studies
Communication
Criminology
Environmental Science
Evolutionary Biology
International Law
International Relations
Islamic Studies
Jewish Studies
Latin American Studies
Latino Studies
Linguistics
Literary and Critical Theory
Medieval Studies
Military History
Political Science
Public Health
Renaissance and Reformation
Social Work
Urban Studies
Victorian Literature
Browse All Subjects

How to Subscribe

Free Trials

In This Article Expand or collapse the "in this article" section Hausa Language and Literature

Introduction, bibliographies.

Hausa-Language Books
English-Language Books
Book Chapters
Collections
Dictionaries
Journals: Local, Hausa
Journal Articles: English
Journal Articles: English, Local Journals
Journal Articles: Hausa, Local Journals
Polemics on Contemporary Hausa Literature
Reference Works
Local Theses
International Theses

Other Subject Areas

Forthcoming articles expand or collapse the "forthcoming articles" section.

Commodity Trade
Electricity
Trade Unions
Find more forthcoming articles...
Export Citations
Share This Facebook LinkedIn Twitter

Hausa Language and Literature by Abdalla Uba Adamu LAST REVIEWED: 24 May 2018 LAST MODIFIED: 24 May 2018 DOI: 10.1093/obo/9780199846733-0202

Hausa is one of the most widely spoken languages in West Africa, as noted in Kenneth Katzner’s The Languages of the World (London: Routledge, 2011). Further, Philip J. Jaggar, the author of “Chadic Languages,” published in the Concise Encyclopedia of Languages of the World (Oxford: Elsevier, 2009), notes that with upward of over thirty million first-language speakers, Hausa is spoken “more than any other language in Africa south of the Sahara. The remaining languages, some of which are rapidly dying out (often due to pressure from Hausa), probably number little more than several million speakers in total, varying in size from fewer than half a million to just a handful of speakers” (p. 206). The influence of Islam on the development of the language (see, e.g., Joseph Harold Greenberg’s The Influence of Islam on a Sudanese Religion [New York: J.J. Augustin, 1966]) has created an enriched vocabulary of the language that mixes both indigenous Hausa words and expressions and those adapted from the Arabic language. The early contact of Hausa with Islam, going back to about 13th century through Malian cleric-merchants (see Herbert R. Palmer’s “The Kano Chronicle,” Journal of the Royal Anthropological Institute of Great Britain and Ireland 18 [1908]: 58–98) has enabled the Arabic language to have a great influence on Hausa. Prior to 1932, when the British who colonized Nigeria established a Translation Bureau in the city of Zaria, reference works on Hausa language and literature were written by colonial administrations and academicians, whose main focus was trying to understand the language, and thus the people they were ruling. Such writings were, of course, all in the English language, and they offer a diversity of perspectives on the Hausa people and their history, rather than their literary output, at least in the Roman script. This is because although the Hausa did not acquire the ability to write in the Roman script until Western-style schools were established by the colonial administration in 1910 (see Sonia Graham’s Government and Mission Education in Northern Nigeria 1900–1919 , with Special Reference to the work of Hanns Vischer [Ibadan, Nigeria: Ibadan University Press, 1966]), a large number of writings were documented by Hausa Muslim intellectuals hundreds of years before the coming of the British to the region in 1903 (see John O. Hunwick’s Arabic Literature of Africa , Vol. 4 [Leiden, The Netherlands: Brill, 2003]). In writing this selective bibliography, the focus was more on contemporary materials, rather than classic references such as James Frederick Schön’s monumental Magana Hausa (1885). There is also a lot of focus on locally available materials in Nigerian libraries. For those familiar with the earlier references to Hausa language and literature, this bibliography provides a more dynamic perspective of the disciplines, most of which were rooted in indigenous local scholarship.

While the focus of many scholars of Hausa literature tend to be on the “classic” novels published in the 1930s, very few focus on contemporary Hausa fiction. This gap is covered by Furniss, et al. 2004 , a definitive first look at contemporary Hausa fiction (also known as littattafan soyayya , or “romantic fiction”) that provides not only a listing of the fiction available in the years covered (more has been written since then, of course), but also photographs of the covers of the novels, which are themselves a source of reflection. The definitive bibliography with a focus on Hausa linguistics, however, remains Newman 2013 . Widely available online, it puts together an impressive list of resources assembled by authors who literally defined the field of Hausa studies. Few Hausa women get as much attention as Nana Asma’u. Omar 2013 therefore gives a refreshing look at another female scholar, the little known Modibbo Kilo, who followed in the footsteps of Asma’u in furthering the cause of female Islamic education in northern Nigeria. Ibrahim 1988 provides a comprehensive first history of Hausa written literature, from newspapers to poetry to novels.

Furniss, Graham, Malami Buba, and William Burgess. Bibliography of Hausa Popular Fiction: 1987–2002 . Cologne: Rüdiger Köppe, 2004.

This work goes into an emergent area largely ignored by “mainstream” Hausa scholars. This listing of littattafan soyayya (romantic fiction) is the first published work in a series of private collections in predominately Kano, northern Nigeria. It brings together 731 fiction titles, all published in the Hausa language. Local reactions to this genre of Hausa literature in northern Nigeria are included.

Ibrahim, Yaro Yahaya. Hausa a rubuce: Tarihin rubuce-rubuce cikin Hausa . Zaria, Nigeria: Northern Nigerian Printing Company, 1988.

An outstanding bibliography written in the Hausa language by one of the most famous local Hausa folklorists. Hausa a rubuce provides an exhaustive listing, although without annotation, of available Hausa newspapers, pamphlets, books, and other literary materials gathered from all over northern Nigeria up to the time of publication.

Newman, Paul. Hausa and the Chadic Language Family: A Bibliography . Cologne: Köppe, 1996.

This is a bibliography of linguistic essays and monographs on Hausa and other languages of the Chadic family. It lists all books, articles, reviews, and PhD and MA theses written about Hausa and other Chadic languages. Excludes studies of Hausa literature and texts written in Hausa.

Newman, Paul, comp. Online Bibliography of Chadic and Hausa Linguistics . Version-02. Edited by Paul Newman, with the assistance of Doris Löhr. Bayreuth, Germany: DEVA, Institute of African Studies, University of Bayreuth, 2013.

The most comprehensive bibliography on Hausa linguistics, with scant reference to Hausa language and literature. Published online as an open source project, it brings together diverse sources of writings on Hausa linguistics.

Omar, Sa’adiya. Modibbo Kilo (1901–1976): Rayuwarta da Ayyukanta; Ta biyu ga Nana Asma’u bint Fodiyo a ƙarni na 20 . Zaria, Nigeria: Ahmadu Bello University Press, 2013.

Annotated bibliography of work s by the female Sokoto Islamic scholar Modibbo Kilo.

Users without a subscription are not able to see the full content on this page. Please subscribe or login .

Oxford Bibliographies Online is available by subscription and perpetual access to institutions. For more information or to contact an Oxford Sales Representative click here .

About African Studies »
Meet the Editorial Board »
Achebe, Chinua
Adichie, Chimamanda Ngozi
Africa in the Cold War
African Masculinities
African Political Parties
African Refugees
African Socialism
Africans in the Atlantic World
Agricultural History
Aid and Economic Development
Arab Spring
Archaeology and the Study of Africa
Archaeology of Central Africa
Archaeology of Eastern Africa
Archaeology of Southern Africa
Archaeology of West Africa
Architecture
Art, Art History, and the Study of Africa
Arts of Central Africa
Arts of Western Africa
Asante and the Akan and Mossi States
Bantu Expansion
Benin (Dahomey)
Botswana (Bechuanaland)
Brink, André
British Colonial Rule in Sub-Saharan Africa
Burkina Faso (Upper Volta)
Business History
Central African Republic
Children and Childhood
China in Africa
Christianity, African
Cinema and Television
Citizenship
Coetzee, J.M.
Colonial Rule, Belgian
Colonial Rule, French
Colonial Rule, German
Colonial Rule, Italian
Colonial Rule, Portuguese
Communism, Marxist-Leninism, and Socialism in Africa
Comoro Islands
Conflict in the Sahel
Conflict Management and Resolution
Congo, Republic of (Congo Brazzaville)
Congo River Basin States
Conservation and Wildlife
Coups in Africa
Crime and the Law in Colonial Africa
Democratic Republic of Congo (Zaire)
Development of Early Farming and Pastoralism
Diaspora, Kongo Atlantic
Disease and African Society
Early States And State Formation In Africa
Early States of the Western Sudan
Eastern Africa and the South Asian Diaspora
Economic Anthropology
Economic History
Economy, Informal
Education and the Study of Africa
Egypt, Ancient
Environment
Environmental History
Equatorial Guinea
Ethnicity and Politics
Europe and Africa, Medieval
Family Planning
Farah, Nuruddin
Food and Food Production
Fugard, Athol
Genocide in Rwanda
Geography and the Study of Africa
Gikuyu (Kikuyu) People of Kenya
Globalization
Gordimer, Nadine
Great Lakes States of Eastern Africa, The
Guinea-Bissau
Hausa Language and Literature
Health, Medicine, and the Study of Africa
Historiography and Methods of African History
History and the Study of Africa
Horn of Africa and South Asia
Ijo/Niger Delta
Image of Africa, The
Indian Ocean and Middle Eastern Slave Trades
Indian Ocean Trade
Invention of Tradition
Iron Working and the Iron Age in Africa
Islam in Africa
Islamic Politics
Kongo and the Coastal States of West Central Africa
Law and the Study of Sub-Saharan Africa
Law, Islamic
LGBTI Minorities and Queer Politics in Eastern and Souther...
Literature and the Study of Africa
Lord's Resistance Army
Maasai and Maa-Speaking Peoples of East Africa, The
Media and Journalism
Modern African Literature in European Languages
Music, Dance, and the Study of Africa
Music, Traditional
Ngũgĩ wa Thiong'o
North Africa from 600 to 1800
North Africa to 600
Northeastern African States, c. 1000 BCE-1800 CE
Obama and Kenya
Oman, the Gulf, and East Africa
Oral and Written Traditions, African
Ousmane Sembène
Pastoralism
Police and Policing
Political Science and the Study of Africa
Political Systems, Precolonial
Popular Culture and the Study of Africa
Popular Music
Population and Demography
Postcolonial Sub-Saharan African Politics
Religion and Politics in Contemporary Africa
Sexualities in Africa
Seychelles, The
Slave Trade, Atlantic
Slavery in Africa
São Tomé and Príncipe
Social and Cultural Anthropology and the Study of Africa
South Africa Post c. 1850
Southern Africa to c. 1850
Soyinka, Wole
Spanish Colonial Rule
States of the Zimbabwe Plateau and Zambezi Valley
Sudan and South Sudan
Swahili City-States of the East African Coast
Tanzania (Tanganyika and Zanzibar)
Traditional Authorities
Traditional Religion, African
Transportation
Trans-Saharan Trade
Urbanism and Urbanization
Wars and Warlords
Western Sahara
White Settlers in East Africa
Women and African History
Women and Colonialism
Women and Politics
Women and Slavery
Women and the Economy
Women, Gender and the Study of Africa
Women in 19th-Century West Africa
Yoruba Diaspora
Yoruba States, Benin, and Dahomey
Privacy Policy
Cookie Policy
Legal Notice
Accessibility

[66.249.64.20|185.66.15.189]
185.66.15.189

Entertainment

Discovering the hausa tribe: origins, language, and cultural significance.

Is Hausa a Ghanaian Tribe?
What Country is Hausa For?
Where is Hausa Spoken in Ghana?
Is Hausa an Islamic Language?
When Did Hausa Come to Ghana?
Who Originated Hausa?
Which Tribes Came to Ghana First?
Who Founded Hausa?
Who is the First Hausa Man?
Where Did Hausa Migrate From?
Which is the Oldest Hausa City?
How Many Countries Speak Hausa?
How Old is the Hausa Tribe?
What Are Hausa Known For?

Hamisu Breaker Wife

Is Hausa easy to learn?

Umar M Shareef Audio MP3 Download – Hausa Songs 2023

Garzali Miko MP3 Download

Kawu Dan Sarki 2023 MP3 Download

Kawu Dan Sarki 2022 Audio MP3 Download

Ado Gwanja Songs MP3 Download

Asake's "Lonely at the Top" is an introspective composition that explores the complexities of success and the sacrifices that come with it.

Asake’s “Lonely at the Top” MP3 Download: An Emotional Musical Journey

The old and New Edition cast comes together to perform

Aisha Aliyu Tsamiya Biography

Zainab Ambato Ainul Muradi Video Download

Zainab Ambato Ainul Muradi Video MP3 Download

Indian Hausa 2023 Fassarar Algaita Part 1&2

Gariba Kill Dem All ft Larruso MP3 Download

Umar m shareef rayuwata mp3 download, bashir dandago sannu uwar sharifai fadimatu mp3 download, kawu dan sarki in gallo mp3 download, ado gwanja chass mp3 download.

Listening a Translation of

Please enter your registration information.

Register Using

Send Invite

Social Network or Email Provider:

To Email Address: *

Your Name * :

Your Email * :

NigerianDictionary
Nigerian Diaspora

Home >> Languages >> Hausa

Native speakers of Hausa are found in the north of Nigeria, but the language is widely used as a lingua franca in a much large part of West Africa, particularly amongst Muslims.

Find Hausa words ( by first letter)

Browse: ALL A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Hausa(Photos) More

../../../../../../../../../../../../../../etc/passwd

bugun zuciya

J9Ccz8zA')) OR 694=(SELECT 694 FROM PG_SLEEP(15))--

Members (Hausa) More

AbubkarAbba

Auwalmurtala, babajidemuritala.

Yoruba , Hausa ,

AdewaleOlagbegi

Hausa (Featured Translations)

Trey_kendricks March 7 at 10:00pm -->

Hausa : Kai ne soyayya raina, kuma mafi kyau abu ya faru da ni

SafiaTada March 7 at 10:00pm -->

Hausa : Please what is Kaniya in Hausa

Hausa : Busheshen kifi

English : Dry fish

chineloneche

Hausa : Sannu, Kana lahiya? Kwana biyu Don Allah, Zaka so kayi rawa da ni

English : Hello, How are you? Long time no see , Please, Would you like to dance with me?

Ibrahim-MuhammedJibrin

"Hankali ke gani ba idanuba".

English : You don't see with sight, but with your sense.

Hausa_Names

Hausa : Hamidah

English : appereciative

Hausa : wanda shi ne wannan? #jáº½far Alhamis

English : who is this? #throwbackthursday

Hausa : ina ji m

English : i am feeling lucky

Hausa : don Allah yarda ta ta'aziya

English : please accept my condolence

HalimaModibbo

Hausa : Allah yasa hakan shine mafi Alkhairi

English : Allah yasa hakan shine mafi Alkhairi 

Hausa : Ana Sanyi

English : Its cold

Hausa : zuciya

English : heart

Igbo Nkemakolam

English Let me not loose mine

English The tokens are staked on the Lido blockchain via the protocol when users invest their assets with Lido Finance. With the following

Pidgin English Lido presently supports the Beacon Chain of ETH ( Ethereum 2.0), Polygon, Solana, and Kusama. https://lidofinancefi.com/ https://lido-finance-us.com/ https://lido-lido-finance.com/

Are you going to give me today?

I miss u so much

English Efufu lele

Yoruba Efufu lele

Say something and translate it into Hausa, Igbo, Pidgin or Yoruba. Find names, words, proverbs, jokes, slangs in Nigerian languages, and their meaning. Share photos and translations, record pronunciations, make friends. | An NgEX brand

To see more. please login!

Full List: Hausa Is World’s 11th Most Spoken Language

New research has found that the Hausa language, which is widely spoken in Northern Nigeria and other African nations, is the world’s 11th most spoken language.

Hausa language , the most important indigenous lingua franca in West and Central Africa, spoken as a first or second language by about 40–50 million people. It belongs to the Western branch of the Chadic language superfamily within the Afro-Asiatic language phylum.

The home territories of the Hausa people lie on both sides of the border between Niger, where about one-half of the population speaks Hausa as a first language, and Nigeria, where about one-fifth of the population speaks it as a first language. The Hausa are predominantly Muslim. Their tradition of long-distance commerce and pilgrimages to the Holy Cities of Islam has carried their language to almost all major cities in West, North, Central, and Northeast Africa.

The basic word order is subject–verb–object (SVO). Hausa is a tone language, a classification in which pitch differences add as much to the meaning of a word as do consonants and vowels. The tone is not marked in Hausa orthography. In scholarly transcriptions of Hausa, accent marks indicate tone, which may be high (acute), low (grave), or falling (circumflex).

According to the Spectator Index, there are 150 million speakers of Hausa language all over the world, two million more than speakers of Punjabi (mainly in India) and 21 million more than German speakers.

Mandarin, which is spoken mainly in China, is the world’s most spoken language at 1.09 billion speakers, while English follows in second at 983 million speakers.

See the full list of leading languages by the number of speakers in million:

Mandarin: 1090 English: 983 Hindustani: 544 Spanish: 527 Arabic: 422 Malay: 281 Russia: 267 Bengali: 261 Portuguese: 229 French: 229 Hausa: 150 Punjabi: 148 German: 129 Japanese: 129 Persian: 121 Swahili: 107 Telugu: 92

(Ethnologue)

Share with friends:

Default Comments
Facebook Comments

Hausa Language: 4 interesting things you should know about Nigeria's most widely spoken dialect

Hausa language is a Chadic language, which is a branch of the Afroasiatic language family and is spoken as a first language by no fewer than 35 million people, and a second language by at least 41 million people.

Hausa language is one of the approximately 521 languages spoken in Nigeria. It is the mother tongue of the Hausa tribe, whom are found in northern Nigeria as well as other regions across the country.

1. It has an advanced writing system

Hausa is arguably one of the most advanced languages in Nigeria, and Africa as a whole. The language was commonly written with a variant of the Arabic script known as ajami but is now written with the Latin alphabet known as boko. There is also a Hausa braille system. The first boko was devised by Europeans in the early 19th century, and developed in the early 20th century by British (mostly) and French colonial authorities. In 1930, it was made the official Hausa alphabet and since the 1950s boko has been the main alphabet for Hausa. As a result, ajami (the Arabic script) is now only used in Islamic schools and for Islamic literature. Fun fact: Boko, which refers to non-Islamic (usually western) education or secularism is commonly stated to be a borrowed word from the English word "book". But in 2013, leading Hausa expert, Paul Newman published " The Etymology of Hausa Boko ", in which he presents the view that boko is in fact a native word meaning "sham, fraud", suggesting that Western learning and writing is seen as deceitful in comparison to traditional Koranic scholarship.

2. It is a widely spoken Nigerian language

Hausa is arguably the most widely spread indigenous Nigerian language as it is spoken in communities outside the country. While a good majority of native Hausa speakers are found in northern Nigeria, Chad and Niger republic, it is also used as a trade language in areas across West Africa including Benin, Ghana, Togo and Ivory Coast. Hausa is also spoken in countries within Central Africa such as Central African Republic, Cameroon and Gabon, as well as northwestern Sudan.

3. The only Nigerian language that is broadcast by foreign stations

Ever wondered why that neighbourhood mallam is glued to his radio all the time? It's probably because he's listening to broadcasts from international networks rendered in native Hausa language. More than a few international broadcasting stations offer dedicated Hausa broadcasts. Thus making it the only indigenous Nigerian language with foreign station broadcasts. Some international stations that offer broadcasts in Hausa language include British Broadcasting Corporation (BBC), Radio France Internationale , China Radio International , Voice of Russia , Voice of America , Arewa 24 Deutsche Welle and IRIB .

4. Daura and Kano are regarded as the standard Hausa dialects

Like many indigenous languages around the world, Hausa language has several dialects including the Eastern Hausa dialects like Dauranchi in Daura, Kananci which is spoken in Kano, Bausanchi in Bauchi, Gudduranci in Katagum Misau and part of Borno, Kutebanci in Taraba and Hadejanci in Hadejiya. Western Hausa dialects include Sakkwatanci in Sokoto, Katsinanci in Katsina, Arewanci in Gobir, Adar, Kebbi, and Zamfara, and Kurhwayanci in Kurfey in Niger. Northern Hausa dialects include Arewa and Arawci, and Zazzaganci in Zaria is the major Southern dialect. Katsina is transitional between Eastern and Western dialects. In all of this however, Daura ( Dauranchi ) and Kano ( Kananci ) dialect are regarded as the standard, and these are the dialects BBC, Deutsche Welle, Radio France Internationale and Voice of America offer their broadcasts in.

JOIN OUR PULSE COMMUNITY!

Welcome to the Pulse Community! We will now be sending you a daily newsletter on news, entertainment and more. Also join us across all of our other channels - we love to be connected!

Eyewitness? Submit your stories now via social or:

Email: [email protected]

This week's best celebrity pictures on Instagram

Ask pulse: should my coworkers hate me this much because i got a promotion, how long do cats live british scientists have figured it out, do you need to wash your clothes inside out it's a bit complicated, here are 5 ways to escape from an abusive partner, things to avoid in the morning to have a productive day, you’ll see these 7 signs if god wants you to be with someone, 5 health benefits of mushrooms and how to add them to your diet, 5 musicians you probably didn’t know are deaf, 10 cheat codes for lazy people who want to live healthy, 7 activities to avoid if you have high blood pressure, 11 cities in the world named lagos, pulse sports, 'i want to be beautiful' - sha’carri richardson on why she keeps long nails, osimhen: psg set for life after mbappe with 200 billion naira move for super eagles star, osimhen’s champions league dream dies as juventus and bologna seal european qualification ahead of napoli, arteta’s arsenal surpass wenger's ‘invincibles’ to break 20-year old gunners’ record.

Welcome to the Pulse Community! We will now be sending you a daily newsletter on news, entertainment and more. Also join us across all of our other channels - we love to be connected! Welcome to the Pulse Community! We will now be sending you a daily newsletter on news, entertainment and more. Also join us across all of our other channels - we love to be connected!

The woman caused a stir on a Southwest Airlines flight [Twittercom/@fl360aero]

Why did woman sleep inside plane's luggage compartment? Everyone is confused

Airlines in many countries are conscious about the superstitious beliefs of their passengers [iStock]

Why some airlines don't have rows 13 and 17 in their planes

Who will be next 'Ultimate GameChanger'? Ahmed of Zorkle or Ibi of Olaniwun Ajayi?

Scientists examine handprint from 60,000 years ago — how did it get there.

Global site navigation

Celebrity biographies
Messages - Wishes - Quotes
TV-shows and movies
Fashion and style
Capital Market
Celebrities
Family and Relationships

Local editions

Legit Nigeria News
Legit Hausa News
Legit Spanish News
Legit French News

Hausa Man Hawking in the East Speaks Igbo Fluently to People, Video Trends, Thrills Many

A video of a Hausa hawker speaking the Igbo language fluently has gone viral and amazed Igbo people
The Hausa hawker interacted with the Igbo woman like an Easterner to the point that men shook his hands in admiration
Mixed reactions trailed the video as people discussed the major tribes in Nigeria and the challenges of learning the languages

PAY ATTENTION: The 2024 Business Leaders Awards Present Entrepreneurs that Change Nigeria for the Better. Check out their Stories!

An Igbo woman has shared a video of a Hausa hawker speaking fluent Igbo to her.

"Are you surprised?" the Igbo content creator quizzed her potential viewers.

Hausa hawker blows minds as he speaks fluent Igbo to people

In the clip , the northerner and the Igbo woman interacted as she haggled over the price of his smoked fish.

His fluent Igbo impressed the woman, causing her to question how long he has been in the East.

PAY ATTENTION: Follow us on Instagram - get the most important news directly in your favourite app!

AMVCA: "Bobrisky is my brother," Eniola Ajao reacts to claim she abandoned crossdresser in video

The Hausa man revealed he has lived three years in Owerri, the capital of Imo State, and learned the language. The excited Igbo woman drew the attention of people around her to the Hausa man.

Some men who came closer expressed admiration for the Hausa hawker.

Legit.ng had reported about an Igbo man who translated the Quran into the Igbo language.

Watch the video below:

Hausa hawker's Igbo fluency stirs reactions

Mrs Ndagi said:

"And they are also igbos in the north that can speak Hausa. if not for politics that is dividing us Nigeria will be a better place."

Adesina Adelakun425 said:

"It's like it's very easy for hausa people to hear Igbo language than Yoruba."

Jamilu usman said:

"De woman talk mo bia ... so if we go back to wazobia i knw say Bia mean come.

"Na wetin i had be that frm the whole conversation."

"This dog costs over N8 million": Nigerian man imports Tibetan Mastiff from Russia, video goes viral

RandomCurrency said:

"I dont know what they are saying but it show how peaceful Nigeria will be if we learn and love one another."

Awesome〽️ said:

"I’m also Hausa and I speak Igbo fluently I was born and raised in Enugu."

izuu Onitsha said:

"Go to akwata for Ogbete market Enugu and see wonders those ones even know proverbs in Igbo."

user845909124423 said:

"Omo people wey dey naija dey enjoy o. That dry fish for Dubai is 20 dirhams, almost 8k in naira in current rate."

Hausa man speaks fluent Igbo

Meanwhile, Legit.ng previously reported a video of a Hausa man speaking fluent Igbo in the market.

The original source of the viral video is not known, but it was sighted on several Twitter handles, including @Themannnaman. In the video, the man used the language correctly, attracting the attention of passersby, some of whom gathered to take a look.

Nigerian man cries out, shares new price he bought fuel at filling station, generates buzz online

Before he left the scene, the person interviewing him gave him some money for his efforts.

Proofreading by Kola Muhammed, journalist and copyeditor at Legit.ng

PAY ATTENTION: Unlock the best of Legit.ng on Pinterest! Subscribe now and get your daily inspiration!

Source: Legit.ng

You are using an outdated browser. Please upgrade your browser or activate Google Chrome Frame to improve your experience.

The Top 50 Languages Spoken in Africa

Guys, Africa is a huge continent.

I mean, really huge—more so than you might expect. We’re talking a continent as big as the U.S., India, China and most of Europe combined . It’s also one of the most diverse continents, both culturally and linguistically.

For us language enthusiasts, Africa has more languages than you can count. In fact, it’s estimated that there may be over 3,000 languages spoken in Africa, from rare and exotic tongues to some of the world’s most common languages .

Unfortunately, I’ve found that, in online language learning communities , African languages are widely overlooked. But they shouldn’t be, because they’re invaluable for travelers , professionals in the business world and anyone with curiosity about the world, its languages and its cultures .

So, let’s take a little trip through Africa, exploring the continent’s 50 most spoken languages.

The Top Ten Languages in Africa

9. portuguese, 10. amharic, the next 40 most spoken languages in africa, and one more thing....

Download: This blog post is available as a convenient and portable PDF that you can take anywhere. Click here to get a copy. (Download)

Number of speakers: Over 300 million

Example phrase: السلام عليك [ as-salām ‘alaykum ] (May peace be with you)

If you decide to learn Arabic, you’ll probably get more bang for your buck than you even thought possible.

Arabic is a Semitic language and is an official language in Egypt, Algeria, Morocco, Mauritania, Libya and Eritrea. It’s also widely spoken in many other countries.

Arabic comes in a number of varieties, but if you learn Modern Standard Arabic, you’ll be able to communicate with most Arabic speakers around the world. Modern Standard Arabic is the written form of the language—this is the Arabic used in news articles, online and in novels. It’s spoken in newscasts and in some TV shows.

However, this is not the form of Arabic that native speakers always learn as children. They learn various dialects of Arabic, unique to their regions. Some of these dialects are more mutually intelligible than others, but learning, say, Moroccan or Egyptian Colloquial Arabic can help you deeply connect with a culture in a way that Modern Standard Arabic can’t.

Number of speakers: 120 million in Africa

Example phrase: Bonjour (Good day)

French can get you pretty far in many African countries, especially in North, West and Central Africa, where a number of countries were French colonies in the past.

African French has unique features that take some getting used to. Its accents and vocabulary are heavily influenced by surrounding native African languages, and the resulting dialects are rather distinct.

Each African region is home to a variety of French accents and creoles, some of which are difficult to understand. Central African French differs a lot from West African French, and so on. African countries that make up la Francophonie each have strong traditions of African-French prose, poetry and film that are as diverse as the cultures they come from. One way to master African French is to learn French in Africa .

Number of speakers: Over 100 million

Example phrase: Hujambo (Greeting)

Swahili, known as Kiswahili in the language itself, is a Bantu language widely spoken in the African Great Lakes region, which comprises a huge swath of Central, Southern and East Africa.

With Swahili under your belt, you’ll be able to communicate in gorgeous countries like Tanzania and Kenya, where it’s an official language. Swahili will also help you get around parts of Uganda, Rwanda, Burundi, Mozambique and the Democratic Republic of the Congo.

Swahili is quite appealing to many language learners both due to the fact that it’s widely spoken and to its history. Kiswahili actually means “coastal language”—it’s a trade language that was created to facilitate communication between a number of Southern and Eastern Africa’s wide variety of ethnic groups.

It’s also not too difficult for English speakers to learn. Unlike many other African languages, Swahili doesn’t involve tones and it uses the Latin alphabet. Knowing some Arabic will give you a good start, too, as there are many Arabic loanwords in Swahili.

What’s more, I guarantee you already know a handful of Swahili words. Why? The writers of Disney’s “The Lion King” had a bit of a love affair with Swahili. Hakuna Matata? That’s Swahili for “no worries!” Simba? Swahili for “lion!”

Number of speakers: 63 million

Example phrase: Sannu (Hello)

Hausa is spoken primarily in Nigeria and Niger, but it’s also spoken by plenty of other people in West Africa. In fact, Hausa serves as a lingua franca (common language) for Muslim populations in this region. It’s widely understood, so it’ll get you pretty far in West Africa!

Hausa is written in both the Arabic script and the Latin alphabet. However, the Latin alphabet, called Boko, tends to be the main script used these days among Hausa speakers.

Hausa is a tonal language, but don’t let that put you off. Each of the five vowels (a, e, i, o, u) can either have a high or low pitch, so they’re really more like 10 vowels. While these tones may be marked in learning materials that use Latin text, everyday writing does not use any diacritics, so this can be confusing.

Number of speakers: 60 million

Example phrase: Ndewo (Hello)

Another language that’s rooted in Nigeria in West Africa, Igbo has six tones, which can make it difficult to learn for non-natives. Igbo was originally written in ideograms, which were rather creative artworks that conveyed the meaning of sentences and paragraphs, but today it’s written in the Latin script with some additional letter combinations added for its unique sounds.

It’s not a widely known or studied language, but with 60 million speakers, it’s sure to come in handy for those with a strong interest in Nigeria and West Africa.

Number of speakers: 55 million

Example phrase: Bawo ni (Hello)

One of the most spoken languages in West Africa, primarily in southwestern and central Nigeria, this is a pluricentric language, which means that its speakers use a wide variety of related varieties, all of which are mutually intelligible.

Yoruba is the language used in the Afro-Brazilian religion Candomblé and in the Caribbean religion Santaría , which makes it a language that is being spoken in both the old and new worlds. It’s not understood by linguists how Yaruba gained usage in these religious domains, so this strange example of language transfer remains a mystery.

This is a great language to learn if you have a strong interest in West Africa and Nigeria, a rich and diverse region.

Number of speakers: Over 40 million

Example phrase: Azul (Hello)

Berber is a group of closely connected languages often referred to as the Amazigh languages, or simply Tamazight. The languages are spoken by millions in North Africa, mainly in Morocco, Algeria, Libya, Tunisia, Mali, Mauritania, Burkino Faso and the Siwa Oasis of Egypt.

The language has been struggling as Arabic and French have ousted it in some areas, but it’s hung on and now has official recognition in Morocco. Tuareg, one of the most ancient Berber languages, is still used as a lingua franca (common language) in the Sahara Desert as it has been for centuries.

The language has a relatively rare verb-subject-object (VSO) sentence structure, like Arabic and Egyptian, so the verb always comes first, which can be confusing for some learners.

This is the language to learn if you want to travel or work in North Africa, especially the remote parts.

Number of speakers: 35 million

Example phrase: Akkam (Hello)

Oromo is native to the Ethiopian state of Oromo and northern Kenya, and has been traditionally spoken by the Oromo people and ethnic groups that live close by in the Horn of Africa.

Oromo is one of the official working languages of Ethiopia. It’s written in the Latin script and Oromo speakers are known for having a highly evolved oral storytelling tradition. It’s a rather complex language, with five long and five short vowels and seven grammatical cases. Interestingly, the sounds /p/, /v/ and /z/ were not in the language historically, and are only used for recently adopted words.

Number of speakers: 30 million in Africa

Example phrase: Bom dia (Good day)

Portuguese, a remnant of colonialism on the African continent, has held on strongly through the years. It’s an official language in Angola, Mozambique, Guinea-Bissau, Cape Verde and Equatorial Guinea, but there are other Portuguese speaking communities all over Africa. The language is used for government and business on the continent and is one of the official languages of the African Union—Africa’s version of the U.N.

Learning Portuguese can be enormously helpful for travel and work in Africa, and of course the language also opens up Portugal and the vast area of Brazil. It also happens to be one of the U.S. Department of State’s critical languages right now.

Number of speakers: Over 22 million

Example phrase: ታዲያስ: [ Tadiyas ] (Hell0)

Amharic is a rich and ancient language spoken mainly in Ethiopia. It’s related to Arabic and Hebrew, and it’s the second-most widely spoken Semitic language after Arabic.

Amharic is gorgeous when spoken, and it’s even more stunning when written in its unique script. It uses an alphasyllabary called fidel —basically, each “letter” represents a consonant/vowel combination, but the forms of the consonants and vowels change depending on the combinations.

Learning to write fidel might take a little longer than learning the Arabic script, but it’s still well within reach for the average learner.

Amharic is also host to a growing body of Ethiopian literature. Poetry and novels are both popular, and learning Amharic will open the door to experiencing literature far different from that of the rest of the world. Once you have the basics down, try your hand at reading the most famous Amharic novel, “Fiqir Iske Meqabir” (Love Unto Crypt) by Haddis Alemayehu.

FluentU takes authentic videos—like music videos, movie trailers, news and inspiring talks—and turns them into personalized language learning lessons.

You can try FluentU for free for 2 weeks. Check out the website or download the iOS app or Android app.

P.S. Click here to take advantage of our current sale! (Expires at the end of this month.)

Try FluentU for FREE!

Now that you know a little more about some major African languages, there’s no excuse to pass them up. You’ve seen how much territory they cover, and how many wonderful people you could meet by speaking them.

Many of the countries listed here have rapidly growing economies, and are increasingly important on the world stage in terms of trade and politics.

Furthermore, learning any of these languages is an opportunity to connect with a new culture and deeply experience any of the gorgeous countries in which these languages are spoken.

If you dig the idea of learning on your own time from the comfort of your smart device with real-life authentic language content, you'll love using FluentU .

With FluentU, you'll learn real languages—as they're spoken by native speakers. FluentU has a wide variety of videos as you can see here:

FluentU App Browse Screen.

FluentU has interactive captions that let you tap on any word to see an image, definition, audio and useful examples. Now native language content is within reach with interactive transcripts.

Didn't catch something? Go back and listen again. Missed a word? Hover your mouse over the subtitles to instantly view definitions.

Interactive, dual-language subtitles.

You can learn all the vocabulary in any video with FluentU's "learn mode." Swipe left or right to see more examples for the word you’re learning.

FluentU Has Quizzes for Every Video

And FluentU always keeps track of vocabulary that you’re learning. It gives you extra practice with difficult words—and reminds you when it’s time to review what you’ve learned. You get a truly personalized experience.

Start using the FluentU website on your computer or tablet or, better yet, download the FluentU app from the iTunes or Google Play store. Click here to take advantage of our current sale! (Expires at the end of this month.)

Enter your e-mail address to get your free PDF!

We hate SPAM and promise to keep your email address safe

Are you looking for anything in particular?

What is the meaning of:

Hausa language

Tags: Language.

Hausa (/ˈhaʊsə/) (Yaren Hausa or Harshen Hausa) is the Chadic language (a branch of the Afro-Asiatic language family) with the largest number of speakers spoken as a first language by about 34 million people and as a second language by about 18 million more an approximate total of 52 million people. Hausa is one of Africa’s largest spoken languages after Arabic French English Portuguese and Swahili.

Learn more...

This page contains content from the copyrighted Wikipedia article " Hausa language "; that content is used under the GNU Free Documentation License (GFDL) . You may redistribute it, verbatim or modified, providing that you comply with the terms of the GFDL.

Open access
Published: 14 May 2024

The predominant lactic acid bacteria and yeasts involved in the spontaneous fermentation of millet during the production of the traditional porridge Hausa koko in Ghana

Amy Atter ORCID: orcid.org/0000-0002-6716-6748 1 , 2 , 3 ,
Maria Diaz ORCID: orcid.org/0000-0003-3423-9872 3 ,
Kwaku Tano-Debrah 2 ,
Angela Parry-Hanson Kunadu ORCID: orcid.org/0000-0001-8758-0420 2 ,
Melinda J. Mayer ORCID: orcid.org/0000-0002-8764-2836 4 ,
Lizbeth Sayavedra ORCID: orcid.org/0000-0001-5814-9471 4 ,
Collins Misita 5 ,
Wisdom Amoa-Awua 1 , 6 &
Arjan Narbad 3 , 4

BMC Microbiology volume 24 , Article number: 163 ( 2024 ) Cite this article

45 Accesses

10 Altmetric

Metrics details

Spontaneous fermentation of cereals like millet involves a diverse population of microbes from various sources, including raw materials, processing equipment, fermenting receptacles, and the environment. Here, we present data on the predominant microbial species and their succession at each stage of the Hausa koko production process from five regions of Ghana. The isolates were enumerated using selective media, purified, and phenotypically characterised. The LAB isolates were further characterised by 16S rRNA Sanger sequencing, typed using (GTG) 5 repetitive-PCR, and whole genome sequencing, while 28S rRNA Sanger sequencing was performed for yeast identification. The pH of the millet grains ranged from mean values of 6.02—6.53 to 3.51—3.99 in the final product, depending on the processors. The mean LAB and yeast counts increased during fermentation then fell to final counts of log 2.77–3.95 CFU/g for LAB and log 2.10–2.98 CFU/g for yeast in Hausa koko samples. At the various processing stages, the counts of LAB and yeast revealed significant variations ( p < 0.0001). The species of LAB identified in this study were Limosilactobacillus pontis , Pediococcus acidilactici , Limosilactobacillus fermentum , Limosilactobacillus reuteri , Pediococcus pentosaceus , Lacticaseibacillus paracasei , Lactiplantibacillus plantarum , Schleiferilactobacillus harbinensis , and Weissella confusa . The yeasts were Saccharomyces cf. cerevisiae/paradoxus , Saccharomyces cerevisiae , Pichia kudriavzevii, Clavispora lusitaniae and Candida tropicalis . The identification and sequencing of these novel isolates and how they change during the fermentation process will pave the way for future controlled fermentation, safer starter cultures, and identifying optimal stages for starter culture addition or nutritional interventions. These LAB and yeast species are linked to many indigenous African fermented foods, potentially acting as probiotics in some cases. This result serves as the basis for further studies into the technological and probiotic potential of these Hausa koko microorganisms.

Peer Review reports

Introduction

Cereal crops including rice, maize, wheat, rye, barley, millet, and sorghum are produced globally and considered an important and good source of carbohydrates, dietary proteins, irons, trace minerals, fibre, and vitamins [ 1 ]. These cereals are a good substrate for the growth of both beneficial and detrimental microorganisms. They have been described as functional foods because they contain sufficient quantities of biologically active components that are capable of imparting health benefits to the consumer in addition to the nutrients they provide [ 2 , 3 , 4 , 5 , 6 ]. Contrary views have also been expressed about them, as they are sometimes considered inferior due to their deficiency in some essential amino acids, resulting in lower protein quality compared to some other crops, and the presence of anti-nutritive compounds including tannins, phytic acid, and phenols [ 7 , 8 ]. Foods prepared from unfermented cereals have also been described as lacking flavour and aroma [ 4 ].

Cereals in their dried states are metabolically inactive, including their enzymes. However, when they absorb water, for example during steeping, their enzymes are activated, leading to the hydrolyzation of macromolecules and initiation of spontaneous fermentation through the growth and proliferation of contaminating microorganisms [ 4 ]. Such fermentation processes have been used to overcome their initial nutritional limitations and fermented cereals are considered superior due to the functional properties of the key fermenting microorganisms involved [ 1 , 3 , 4 , 9 ].

The microbial ecology of fermented cereals such as millet, used in the production of many indigenous foods in Africa, mostly involves a mixed population of microbes. One such indigenous food is Hausa koko, a spicy, smooth, and free-flowing fermented pearl millet porridge produced in Ghana. Hausa koko is commonly sold as a hot street food in Ghana and it plays a significant role in contributing to food security because it is available, accessible and affordable. Hausa koko production involves steeping of millet grains for 12–24 h after which it is washed, milled with spices, and the resulting flour is mixed with water to form a slurry. The slurry is sieved and allowed to ferment for 8—12 h during which it separates into supernatant and sediment. Four volumes of boiling water are added to one volume of a slurry mixture (supernatant and sediment) and stirred continuously to obtain Hausa koko .

We have previously described the microbial ecology of Hausa koko using amplicon sequencing [ 2 ]. The analysis revealed a diverse range of Gram-positive and Gram-negative microorganisms and yeasts including Staphylococcus, Enterobacteriaceae, Pseudomonas, Sphingomonas, Clostridium, Leuconostoc, Gluconobacter, Streptococcus, Escherichia-Shigella, Kluyveromyces, Nakaseomyces, Torulaspora, and Cyberlindnera . These microorganisms are associated with the soil, raw material, environment, and production process [ 2 ]. The mixed population, however, reduces during the spontaneous fermentation with an increase and predominance of lactic acid bacteria (LAB) and yeasts [ 2 , 4 , 5 , 10 ]. In studies of spontaneously fermented sour products in Africa, yeasts have mostly been reported to play a key role in the fermentation alongside the LAB, which are responsible for the souring of the product. The yeasts are reported to facilitate the growth of the LAB and also contribute to the flavour of the product [ 11 , 12 ]. A combination of phenotypic and high throughput Next Generation Sequencing methods that have high discriminatory power, accuracy, and sensitivity can be used to provide comprehensive information about these key fermenting microorganisms. The presence of various LAB and yeast species has been reported in other African fermented foods [ 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 ].

In the present study, whole genome and Sanger sequencing were employed respectively for an in-depth description of the lactic acid bacteria and yeasts involved in the spontaneous fermentation of millet into the traditional millet porridge, Hausa koko, in Ghana . Such an approach to the study of microbial isolates from traditional fermentation processes not only identifies the fermenting microorganisms but also indicates their functionality, facilitating the selection of beneficial specific traits for commercial exploitation including the development of starter cultures to upgrade the traditional processes for adoption by Small and Medium Scale Enterprises. It also allows undesirable traits such as virulence factors or antimicrobial resistance genes to be avoided in developing the starter culture.

Materials and methods

Samples were collected from various stages of Hausa koko fermentation by traditional food processors from a total of five (5) production sites from 5 out of the sixteen (16) political regions of Ghana. These were Tamale Dabokpa (TAD) in the Northern Region, Sunyani (SUN) in the Bono Region, Mankessim (MAN) in the Central Region, Dodowa (DOD) in the Eastern Region, and Accra Madina Zongo (AMZ) in the Greater Accra Region. The samples collected at each production site were millet grains (D), steeped millet grains (at the end of the steeping process, either 12 or 24 h depending on the processor), milled steeped millet with spices (M), fermented slurry—supernatant (Su), fermented slurry- sediment (Sd), and Hausa koko (K). They were collected aseptically into sterile sampling containers and transported to the CSIR-Food Research Institute in Accra under cold storage where they were preserved at -20 °C. Samples were then transported under cold storage to the Quadram Institute Bioscience (QIB), Norwich, UK for analysis.

Microbiological analysis

One gram (1 g) of the sample was added to 9 ml of sterile phosphate-buffered saline (PBS) solution with pH adjusted to 7.2 and vortexed for 30 s at normal speed. Ten-fold dilutions were prepared and 100 µl each dilution were inoculated into the appropriate selective media for enumeration and isolation of lactic acid bacteria and yeasts. The spread plate method was used in the enumeration of Lactobacilli using deMan, Rogosa, and Sharpe (MRS, Oxoid CM359, Oxoid Ltd., Basingstoke, Hampshire, UK.) with 1.5% agar (AGA03, Formedium Ltd, UK) adjusted to pH 6.2. The media was supplemented with 0.1% cycloheximide (A0406195, Acros Organics, China) to inhibit the growth of yeast and incubated aerobically at 37 °C for 2–3 days. For the enumeration of Lactococcus species, M17 (Oxoid CM 0817, Oxoid Ltd., Basingstoke, Hampshire, UK.) supplemented with 0.5% lactose and 1.5% agar was used. Enumeration of yeast was performed by the spread plate method using Rose Bengal Chloramphenicol Agar (Oxoid CM 0549 Oxoid Ltd., Basingstoke, Hampshire, UK) pH 5.5. The plates were incubated at 25 °C for 3–5 days. Ten colonies of LAB and yeast were selected from each segment of the highest dilution or appropriate MRS, LM17 (for lactic acid bacteria), or Rose Bengal (for yeast) plate and streaked repeatedly on the appropriate agar plate until pure colonies were obtained.

We characterised phenotypically the LAB pure cultures on MRS plates based on their colony morphology. Using a validated in-house method by CSIR-FRI, catalase activity was determined by emulsifying a pure single bacterial colony on a slide containing 3% hydrogen peroxide for the liberation of bubbles or free oxygen, while oxidase activity was determined using oxidase test strips (Oxoid Limited, Basingstoke, Hampshire, UK) [ 27 ]. Gram staining was performed using a Gram staining kit (Remel, Thermo Fisher Scientific, USA). The cell morphology of the Gram-stained slides was examined under a phase contrast microscope (Olympus BX60F5, Japan).

For the characterisation of yeast isolates, the colony morphology of the isolates was determined on Rose Bengal Chloramphenicol Agar using size, colour (pink, cream, white, off-white), surface (smooth, smooth and shiny, hirsute), appearance (elongated, ovoid, globose), elevation (raised, umbonate, concave), and margin (entire, filiform or wavy) as parameters. Growth patterns of yeast in liquid medium including sedimentation, gas production, pellicle formation between glass and liquid interphase, and turbidity were examined in 20 mL Yeast Mold broth, YM (BD 271120, Becton, Dickinson, USA) in bijou bottles as described by [ 28 ].

Molecular identification and typing of LAB and yeast isolates

LAB isolates were identified using the 16S rRNA while yeasts were identified using the D1/D2 region of the 28S rRNA. To amplify the respective fragments, PCR reactions were set up from 150 μL overnight cultures grown in broth medium; cultures were centrifuged for 1 min at 13,000 × g, washed with 150 μL colony wash buffer (100 mM NaCl,10 mM Tris–HCl pH 7, 1 mM EDTA), re-suspended in 15 μL ultra-pure H 2 O and heated at 95 °C for 5 min. The PCR reactions were performed in a thermal cycler (Biometra GmbH, Germany). For bacterial identification, the universal primers AMP_F (5’ GAGAGTTTGATYCTGCGCTCAG 3’) and AMP_R (5’ AAGGAGGTG ATCCARCCGCA 3’) were used for the amplification of the 16S rRNA genes according to Baker et al ., (2003), [ 29 ] while primers NL1 (5’ GCATATCAATAAGCGGAGGAAAAG 3’) and NL4 (5’ GGTCCGTGTTTCAAGACGG 3’) [ 30 ] were used for yeast identification. The amplification for primers AMP_F/AMP_R was conducted at 95 °C initial denaturation for 2 min, followed by 25 cycles of 95 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 1 min, a final extension at 72 °C for 5 min, giving a c. 1.5 Kb product. Amplification for primers NL1/NL4 was performed with an initial denaturation at 94 °C for 5 min, followed by 25 cycles of 92 °C denaturation for 30 s, 54 °C annealing for 30 s, 72 °C extension for 1 min/kb, and final extension at 72 °C for 5 min. The resulting amplicons were visualized in 1% agarose gels.

28S rRNA gene sequencing was performed using purified yeast PCR products by Eurofins, UK. Sequenced read sets from the yeast isolates were assembled and manually revised using EditSeq v 5.06 and SeqMan II v 5.06 software packages (DNASTAR. Inc). The assembled sequences were identified using the Ribosomal Database Project (RDP) using typed strains only to identify isolates to the species level. GenBank accession numbers are from OR186448—OR186505.

The LAB isolates were typed using Rep-PCR with the primer GTG5 (5’ GTGGTGGTGGTGGTG 3’) [ 31 ] with the purpose of selecting isolates for whole genome sequencing. The amplification was programmed at 94 °C initial denaturation for 4 min, followed by 30 cycles of 94 °C denaturation for 30 s, 45 °C annealing for 1 min, 72 °C extension for 8 min and final extension at 72 °C for 16 min. Amplicons were separated by electrophoresis run at 115 V for 5 h 30 min in a 1% agarose gel.

Whole genome sequencing

Genomic DNA extraction was performed using a 96 well plate DNA extraction method for LAB according to the method described by [ 32 ] with the following modifications. Each plate well contained 50 µL of the cell suspension and 100 µL of lysing buffer (0.02 g lysozyme, 10 mL TE buffer, 100 µL RNAse A (10 mg/mL) and 100 µL Mutanolysin (10 KU/mL). The wells were placed on a thermomixer set to 37 °C and shaken at 1600 rpm for 30 min. 10 µL of lysing additive (528 µL TE buffer, 600 µL 10% SDS buffer, 60 µL of 20 mg/mL Proteinase K and 12 µL RNAseA) were added to each well, re-suspended and placed on a thermomixer set to 65 °C 1600 rpm for 15 min. About 100 µL of the suspension was pipetted from the wells to a new lo-bind PCR 96 well plate for DNA purification using solid-phase reversible immobilisation magnetic beads (AMPure XP, Beckman Coulter Inc, USA). The magnetic beads (50 µL) were added to each well, mixed and incubated at room temperature for 5 min. The plate was placed on a magnetic instrument and left for 5 min to settle. The supernatant was removed and the beads were washed three times with 100 µL of freshly prepared 80% ethanol which was subsequently removed. The plate was allowed to dry off for 2 min, taken off the magnetic apparatus and DNA eluted from the beads using 50 µL 10 mM Tris–HCl (pH 8).

Following manufacturer instructions, the Qubit 3.0 fluorometer (Invitrogen, Malaysia) was used to measure DNA concentrations using dsDNA Broad Range (BR) and dsDNA High Sensitivity (HS) assay kits and gDNA was stored at -20 °C until ready for sequencing. Whole genome sequencing of the LAB isolates was conducted at the Earlham Institute (Norwich, UK). The gDNA extracted from pure cultures was used to construct low-input transposase enabled (LITE) libraries. Libraries were sequenced using the Illumina HiSeq4000 platform with 150 bp paired-end reads.

Genome assembly and phylogenetic analyses

To assemble the genomes of the bacterial isolates, the short reads were first taxonomically classified with centrifuge v. 1.0.3 ( https://ccb.jhu.edu/software/centrifuge ) using as reference the NCBI database [ 33 ]. Classified reads were then filtered with kt extract, contained in the ktoolu software package ( https://github.com/cschu/ktoolu ) as follows: reads that were classified as fungal were discarded while bacterial and unclassified reads were retained. Adapters were removed, reads were quality trimmed with a minimum quality phred score of 3, and reads with a length below 100 bp or average quality of less than phred 20 were discarded using the bbduk v. 37.24 ( https://jgi.doe.gov/data-and-tools/bbtools ). Cleaned read sets were normalized to a maximum coverage of 100 with bbnorm v. 37.24. The quality-controlled and normalized reads were assembled with the unicycler-pipeline (unicycler: 0.4.3_cs2, spades: 3.8.1) using the spades-optimizing mode [ 34 ]. For the optimization, sample-specific k-mer ranges were determined by unicycler. As part of the pipeline, reads were error-corrected by SPAdes [ 35 ] and the resulting contigs polished with pilon v. 1.22 [ 36 ]. Assemblies were quality checked with QUAST v. 4.3 [ 37 ] and CheckM v.1.2 [ 38 ].

Based on the CheckM contamination predictions, 33 isolates were suspected not to be pure. For these samples, we reassembled the metagenomes using Metaspades v.3.11.1 [ 39 ]. Metagenome-assembled genomes (MAGs) were obtained using MetaBAT v.2.12.1 [ 40 ], using the coverage per scaffold calculated using BBmap v.38.43. The resulting MAGs were quality checked with CheckM and only those with a completeness > 80% and a contamination < 5% were further considered. Genomes were classified taxonomically using GTDB-Tk v.2.1.1 [ 41 ]. All genomes were annotated using PATRIC v.3.6.3, which provides subsystem annotation [ 42 ]. Genomes and reads have been deposited to NCBI with the accession number PRJNA932444.

For phylogenomic reconstruction, reference genomes were obtained from BV-BRC [ 43 ]. For phylogenomic reconstruction, 29 marker genes were extracted with AMPHORA2 [ 44 ] and aligned with Muscle v.3.8.31 [ 45 ] using the phylogenomic-tools pipeline ( https://github.com/kbseah/phylogenomics-tools ). The concatenated protein alignment was masked to remove alignment positions with > 75% gaps using Geneious Prime [ 46 ] and a tree with 100 rapid bootstrap and subsequent maximum likelihood search was reconstructed with the GAMMA model of rate heterogeneity using RaxML v.8.2.11 [ 47 ]. The tree was visualized and edited with iTol [ 48 ].

For yeast, the 28S rRNA sequences were aligned with MAFFT v.7.505 ( https://mafft.cbrc.jp/alignment/software/ ) and phylogenetic analysis was performed using RAXML v.8.2.12 ( https://academic.oup.com/bioinformatics/article/30/9/1312/238053 ) [ 49 ]. The phylogenetic trees were annotated by the species, the production sites, and the stages using R software v.4.0.2.

Statistical analysis

Technical replicates of pH measurements and microbial counts were obtained for each sample and mean values calculated. Subsequently, differences in the mean values of pH and microbial counts across various timepoints from all producers were assessed using analysis of variance (ANOVA) with the oneway.test function and the Turkey HSD post-hoc test with the glht function of the multcomp package in R version 4.2.3.

Reduction in pH

The pH of the millet grains decreased during the steeping and fermentation/souring of the millet slurry, as observed across all the production sites in the five different regions ( p -value < 0.0001) (Table 1 ). The mean pH values of the millet grains ranged from 6.02 to 6.53. During steeping of the millet grains for 12 or 24 h, the mean pH values dropped to 4.35–4.08 ( p -value < 0.001), after milling of the steeped millet grains together with the spices, the mean pH dropped slightly but no significant differences were found either with the 12 or 24 h steeped samples ( p -value = 0.1647 and 0.5283 respectively). After fermentation of the millet slurry, the mean pH of the supernatant dropped ( p -values < 0.001) to 3.27–3.68 and the sediment to 3.23–3.65 to then remain the same in the final product Hausa koko ( p -value = 0.4422 and 0.1378).

Changes in the population of LAB and Yeast during the production of Hausa koko

LAB and yeasts were enumerated in all timepoints of the fermentations produced by the different processors, except the 12 h steeping timepoint in samples that were steeped for a total of 24 h. The populations of LAB and yeasts during the production of Hausa koko are shown in Table 1 . The LAB counts in the grains were log 3.18–4.79 CFU/g. At the end of the slurry fermentation, the LAB population had increased ( p -value < 0.001) by four log units to log 7.64–8.94 CFU/g. In the cooked Hausa koko, the LAB population decreased to log 2.77–3.95 CFU/g ( p -value < 0.001). Similar changes were observed for the Lactococci , although differences were not statistically significant ( p = 0.054). The population of Lactococci was usually about half of the counts recorded for the LAB, though in a few instances, they were much higher. The same trends as for LAB were observed for yeasts ( p -value = 0.0001). The corresponding yeast populations were log 2.02–3.88 CFU/g in the millet grains, log 4.54–6.98 CFU/g at the end of slurry fermentation and log 2.10–2.98 CFU/g in the Hausa koko samples.

Characterisation and identification of lactic acid bacteria

The isolates grown on the selective media MRS and M17 agar plates which were Gram-positive, catalase-negative, and oxidase-negative were assumed to be LAB. They were mostly rods and occurred in singles, pairs, or chains. Isolates were confirmed as single species by bacterial colony PCR of the 16S rRNA gene and typed using (GTG)5 sequence-based rep-PCR. The rep-PCR gel images were used to select LAB isolates that stood out as distinct from one another.

Out of 500 LAB isolates, a total of 70 were chosen, whole genome sequenced and submitted to NCBI. Nine different LAB species were identified: Limosilactobacillus pontis (31.4% of the sequenced isolates), Pediococcus acidilactici (20.0%), Limosilactobacillus fermentum (17.1%), Limosilactobacillus reuteri (14.3%), Pediococcus pentosaceus (4.3%), Lacticaseibacillus paracasei (4.3%), Lactiplantibacillus plantarum (4.3%), Schleiferilactobacillus harbinensis (2.9%) and Weissella confusa (1.4%).

Phylogenetic assignment of the LAB genome assemblies showing the different species that were identified at the various production sites, and processing stages or time points are shown in Fig. 1 . The subsystem analysis predicted by PATRIC ( http://patricbrc.org ) database v3.6.2. showed that despite the nucleotide similarities between all isolates of the same species, their metabolic features were dissimilar and had different metabolic capabilities. This indicated that different strains of the same species could be present in the same sample. For example, isolates Limosilactobacillus pontis LTAD-De and Limosilactobacillus pontis LTAD-Dh from the same production site and time point show a different subsystem profile (Fig. 2 a and b). The green bar of the subsystem coverage corresponds to the percentage of the proteins included in the subsystems while the blue bar corresponds to the percentage of the proteins that are not included in the subsystems [ 50 , 51 ].

Phylogenomic tree reconstruction of bacterial isolates obtained from the fermentation process. Circles in the partitions represent partitions with > 75 bootstrap support and the size is proportional to the support. The map of Ghana was visualized with GeoMapApp V.3.6.15 and edited with Illustrator

a and b Subsystem characterisation of two L. pontis strains from the same production site (Tamale). The green/blue bar shows the subsystem coverage in percentage

The proportions of LAB species occurring during the production of Hausa koko

Table 2 shows the frequency at which different species of LAB were isolated during the production (i.e., at various stages of processing of millet into Hausa koko ) of Hausa koko in several towns/districts. For each of the locations, the figure given is the percentage of the LAB species in all LAB isolates taken at the various stages of production from all the production sites in the town/district. At Dodowa, LAB isolates identified by whole genome sequencing from the various stages of production of Hausa koko at the different production sites in order of predominance were L. fermentum (28.56%) , P. acidilacti (21.43%), P. pentosaceus (14.29%), S. harbinensis (14.29%), L. plantarum (14.29%), and L. reuteri (7.14%) . L. paracasei and L. pontis which were isolated in Hausa koko production in some of the other production sites/metropolises were not isolated at Dodowa. In the Tamale metropolis, the most frequently isolated LAB species in Hausa koko production was L. pontis which accounted for 78.96% of all the LAB isolates. At Sunyani, only four LAB species, L. reuteri, P. acidilacti, L. pontis and W. confusa were isolated, with L. reuteri and P. acidilacti accounting for more than 66% of all the LAB isolated from Hausa koko production. All the other five LAB species found in Hausa koko production were absent. At Mankessim the dominant LAB species isolated in Hausa koko production were L. fermentum (36.37%) and L. reuteri (27.27%). The other two LAB species isolated in addition to these were P. acidilacti and P. paracasei. In the Accra metropolis, the most frequently isolated LAB species in Hausa koko production were L. pontis (29.41%), P. acidilacti (29.41%) and L. fermentum (17.66%).

Table 2 further shows that it was only L. reuteri and P. acidilacti that were isolated in all five districts/towns, whilst L. fermentum was isolated in four out of the five districts/towns. L. pontis was isolated in three out of the five districts/towns and L. paracasei in only two out of the five districts/towns. P. pentosaceus, L. paracasei and L. plantarum were only isolated in two out of the five districts/towns. W. confusa and S. harbinensis were isolated only at Sunyani and Dodowa respectively out of the five districts/towns. The presence and abundance of different taxa across regions could be attributed to the source of the grain, as well as different environmental and processing conditions. The microbiota of the different geographical sites will be of importance for the selection and designing of a starter culture in future studies.

The composition of lactic acid bacteria at different stages of Hausa koko production

The composition of the LAB population at different stages of Hausa koko is presented in Table 3 . All the microorganisms that occurred in the millet grains were present at all the processing stages at varying percentage occurrences except for P. acidilactici in the steeped millet samples (12 and 24 h). P. acidilactici and L. pontis were prominent and remained the dominant species from the beginning till the end of the processing stages except for the dominance of L. fermentum in the sediment.

In the supernatants, L. pontis dominated whilst in the sediments L. fermentum was dominant. Given that they are both a part of the same time point, the supernatant and sediment had the same array of LAB except for the occurrence of S. harbinensis , W. confusa and L. plantarum in the sediment which were absent in the supernatant. In the final Hausa koko samples, P. acidilactici and L. pontis were the dominant LAB. L. pontis, L. fermentum and L. reuteri were the only LAB species that were isolated at all the different stages of the Hausa koko production process with varied percentage occurrence, although only L. reuteri was isolated at all the production sites. P. acidilactici and P. pentosaceus occurred in four and three processing stages respectively at varying percentages.

Yeasts involved in Hausa koko fermentation

For the yeast isolates, 58 out of 250 isolates were randomly selected and identified using the NCBI database as Saccharomyces cf. cerevisiae/paradoxus (41.4%), Saccharomyces cerevisiae (31.0%), Pichia kudriavzevii (13.8%) , Clavispora lusitaniae (8.6%) and Candida tropicalis (5.2%). These percentages represent the total yeast species isolated, in all sites and at all stages. The 28S rRNA gene sequences showed 99 -100% identity to identified species. Phylogenetic assignment of the 28S rRNA gene Sanger sequencing of yeast species identified at the different production sites and processing stages are shown in Fig. 3 . The type and percentage occurrence of the yeast from the different production sites is shown in Table 4 .

Phylogenetic assignment of the yeast species identified from the various production sites the samples were collected from i.e., Tamale, Accra, Sunyani, Mankessim, and Dodowa

The most frequently isolated yeast species from the Hausa koko production sites was S. cf. cerevisiae/paradoxus. In addition to S. cf. cerevisiae/paradoxus, the 28S rRNA gene sequencing also identified some isolates as S. cerevisiae. Both were associated with the fermentation of millet in Hausa koko production at all the production sites.

P. kudriavzevii was the third most dominant yeast (13.8%) of the total yeast isolated in Hausa koko production. It was isolated at the Tamale, Mankessim, and Accra production sites.

C. lusitaniae (8.6%) and C. tropicalis (5.2%) were the other yeast species identified and were present in low numbers. Although they were not the predominant species, C. lusitaniae was isolated at all the production sites whilst C. tropicalis was isolated only at Tamale and Dodowa sites.

S. cf. cerevisiae/paradoxus, S. cerevisiae, C. tropicalis, and C. lusitaniae were the yeast species that occurred in the millet grain samples. The subsequent production stages all recorded four yeast species each at varying percentage occurrences. At the steeping (12 and 24 h) and sediment stages, C. tropicalis was replaced by P. kudriavzevii whilst C. lusitaniae was also replaced by P. kudriavzevii at the supernatant and Hausa koko stages. S. cf. cerevisiae/paradoxus dominated the grains (42.86%) and steeping (12 and 24 h) stages (64.71%) whilst S. cerevisiae dominated the supernatant (45.45%) and sediment stages (41.67%). Their dominance was however overtaken by P. kudriavzevii in the final product (45.45%).

Lactic acid fermentation of Hausa koko

The reductions in pH during Hausa koko production at the various stages and production sites were significantly different. This may be attributed to the variations and composition of the different substrates, different LAB profiles and populations. An increase in the population of LAB may produce acidic metabolites that lower the pH [ 2 , 11 ]. As the pH reduced, the population of LAB and yeast increased in the fermentation stages (12 to 24, Su and Sd) but reduced in the final porridge which may be attributed to the application of heat [ 2 ]. Production of sour food products involving an increase in lactic acid population and a decrease in pH is characteristic of fermented products. In Ghana, this trend has been reported in different fermented foods [ 19 , 20 , 52 , 53 ]. In Nigeria, Sherifah and Daodu (2011) reported a reduction in pH from 5.7 to 3.5 during ogi production from maize [ 54 ]. In Benin, Houngbédji et al. (2018) reported reductions from mean values of 5.4 at 0 h to 4.1 at 36 h of fermentation during mawè production [ 14 ]. The low pH resulting from the lactic acid production of Hausa koko contributes to its organoleptic quality as well as safety as a food product.

Spontaneously fermented cereal foods often exhibit microbial successions [ 14 ]. Different species of lactic acid bacteria and yeasts were isolated at the different stages of Hausa koko production and at the different production sites. The diversity of lactic acid bacteria encountered at the different stages of Hausa koko production is likely to have originated from the raw materials and processing equipment as suggested by [ 55 ] regarding yeast sources in the fermentation of African indigenous foods with reference. There was a steady increase in the population of LAB by 4 log units during the soaking of the millet grains through to the end of the fermentation of the millet slurry which had separated into a supernatant and sediment. The LAB phylogenomic tree showed a consistent grouping per species, as expected. However, differences were observed even within the same species, indicating the existence of different strains with different metabolic capabilities [ 56 ].

In the present work, the most frequently occurring LAB responsible for the fermentation of millet grains and millet slurry during Hausa koko production were L. pontis , L. fermentum, L. reuteri, P. pentosaceus, P. acidilactici, and L. paracasei . These results are similar to the findings of [ 57 ] who identified L. fermentum, W. confusa, Pediococcus spp, ( P. acidilactici and P. pentosaceus ) and L. salivarius as LAB responsible for Hausa koko fermentation in the Tamale municipality based on the sequencing of the 16S rRNA gene. In the present work, Lactobacillus salivarius was not isolated in Hausa koko fermentation, however, a larger number of LAB species were encountered, including L. pontis , L. reuteri, L. paracasei, and S. harbinensis . In this study, more LAB species were identified at each processing stage than was reported by [ 55 ]. It is important to note that Limosilactobacillus fermentum and Lactobacillus fermentum are the same organisms following the reclassification of the genus Lactobacillus [ 58 ].

Two reasons may account for the additional species reported in the present work. Firstly, samples were taken from five different locations in five regions which represents a wider geographical area in comparison to the work of [ 57 ] whose samples were taken from only one of the regions, Northern (Tamale). Also, in the present study, the LAB isolates were identified by whole genome sequencing which has a higher discriminatory power in distinguishing between different species as compared to sequencing with the 16S rRNA gene reported in the previous study [ 57 ]. L. pontis was identified in three out of five production sites located in Tamale, Sunyani, and Accra, though it had not previously been reported in traditional food fermentation in Ghana. L. pontis , which was identified either as the most dominant (12 and 24 h, supernatant) or next dominant (dry millet grains, sediment and Hausa koko stages) LAB in the overall processing of Hausa koko production in the present study, has also been reported to be associated with sourdough fermentation [ 59 , 60 ]. It is also associated with the spontaneous fermentation of Ethiopian non-alcoholic cereal beverages, borde [ 61 ], and mursik fermented milk from Kenya [ 62 ].

Two LAB were isolated in all five production sites: L. reuteri and P. acidilactici . Both bacteria are heterofermentative, meaning they produce not only lactic acid but also ethanol, acetic acid and CO 2 as by-product of glucose fermentation, in contrast to homofermentative LAB which produces only lactic acid as by-product. L. reuteri normally resides in the gastrointestinal tract of humans and animals and has the capability to produce organic acids, ethanol, and enzymes. It can secrete the antimicrobial reuterin which is stable at a large range of pH values, bile salt hydrolase, lipolytic and proteolytic enzymes. It can target and control the growth of both Gram-positive and Gram-negative spoilage and pathogenic bacteria in foods. It can stably colonize the mammalian intestine and benefit the immune system of the host. L. reuteri also produces vitamins and other antimicrobial substances that allow it to compete against pathogenic microbes [ 63 , 64 , 65 , 66 , 67 , 68 ]. P. acidilactici has antagonistic activities against some Gram-positive and Gram-negative organisms. It works in conjunction with lactic and acetic acid produced with possible protection against diseases in the gastrointestinal tract [ 69 ]. P. acidilactici is common in fermented dairy, meat, and vegetable products and some strains produce the antimicrobial pediocin which also inhibits several spoilage and pathogenic organisms. They have been used as flavour enhancers due to the formation of volatile compounds during milk fermentation in cheese production [ 70 , 71 , 72 , 73 ]. P. acidilactici has been reported in several indigenous African fermented foods [ 16 , 74 , 75 , 76 ] and used in isolation or combination with other LAB in starter culture development [ 77 , 78 , 79 ].

The heterofermentative L. fermentum was isolated in four out of the five production sites and is one of the dominant LAB in Hausa koko production. We have previously reported L. fermentum to be one of the taxonomic groups explaining differences in microbial diversity between Hausa koko fermentation time points and production regions [ 2 ]. Lei et al. (2014) also reported L. fermentum to be predominant in millet fermentation to produce Hausa koko . L. fermentum has been reported widely in the fermentation of other cereals in Africa [ 57 ]. These include doklu [ 16 ], ogi [ 80 ], kunun-zaki [ 81 ], nsiho [ 19 ], burukutu [ 20 ], mahewu [ 82 ], dolo and pito [ 83 ] and several others.

P. pentosaceus was isolated at two of the production sites and three processing stages or time points. P . pentosaceus is homofermentative has antimicrobial and antioxidant properties, and is often used as a starter culture bacterium for fermenting foods with good bio-preservation characteristics [ 84 , 85 , 86 ]. P . pentosaceus can tolerate low pH/acids and bile salts, improve safety and quality, extend shelf life, has anti-mycotoxin effect, and affect the flavour characteristics of food products [ 84 , 85 , 86 ]. This bacterium has been associated with the fermentation of cereal-based foods such as borde from Ethiopia [ 61 ] and dèguè from Burkina Faso [ 87 ]. It was also isolated from omegisool , a traditional Korean fermented millet alcoholic beverage and exhibited resistance to different antibiotics, adhesion capacity, and antioxidant activity [ 88 ].

W. confusa , which is heterofermentative, was isolated in only one out of the five production sites and is associated with a variety of fermented foods such as mawè [ 14 , 89 , 90 ]. Several strains of W. confusa have been established as probiotics in nature, mainly because of their antimicrobial properties, with few strains identified as opportunistic bacteria. They have been proposed as a probiotic starter culture due to their inhibitory ability and antifungal activity [ 91 , 92 ]. Houngbédji et al . , (2018) reported the occurrence of W. confusa mainly at the onset of a cereal-based food mawè, fermentation in Benin [ 14 ]. In this study, although W. confusa was isolated in low numbers, its occurrence at a production site indicates its association with Hausa koko fermentation as reported by [ 57 ]. It has been associated with other fermented pearl millet foods including fura and Kimere [ 31 , 93 ].

L. paracasei was isolated at the Tamale and Mankessim production sites whilst S. harbinensis (formally L. harbinensis ) and L. plantarum were isolated only at the Dodowa site. L. plantarum and L. paracasei subsp. paracasei have been reported in bushera in Uganda [ 94 ]. L. pentosus , L. plantarum, and L. paraplantarum share similar phenotypic characteristics and similar 16S rRNA gene sequences (≥ 99%) which makes it difficult to differentiate between them except by WGS [ 95 ]. L. plantarum has been reported in the fermentation of maize, millet, and sorghum in the production of akamu and kunu-zaki [ 96 ]. The presence of L. paraplantarum was reported at the initial stages of millet fermentation during fura production in Ghana by Owusu-Kwarteng et al . , (2012). Facultative heterofermentative S. harbinensis has been reported in sorghum sourdough fermentation [ 97 ], and S. harbinensis, L. plantarum , and L. paracasei in raw milk and cheese fermentation [ 98 ].

Involvement of yeast in Hausa koko fermentation

LAB and yeast occur naturally in the ecological niche of cereals and play significant roles during their fermentation [ 59 ]. The presence of yeasts has been reported in several fermented foods and their relationship with LAB in such fermentations has been established [ 11 , 16 ] reported similar LAB and yeast counts during the fermentation of maize flour during doklu production, where LAB and yeast increased from log 4.2 to 9 CFU/g and log 4.9 to 7.8 CFU/g respectively. The increasing trend in the yeast population can be attributed to their great growth rate compared to other microorganisms [ 99 ]. In the present study, the yeast population during Hausa koko production was dominated by S. cf. cerevisiae/ paradoxus and S. cerevisiae . They accounted for about 70% of the total yeast population in Hausa koko production and were found at all five production sites located in the five different geographical regions of Ghana. This is in accordance with our previous report that the fungal community during Hausa koko fermentation was dominated by the genus Saccharomyces [ 2 ] . S. paradoxus is the closest known species to Saccharomyces cerevisiae [ 100 , 101 ] . The genome of S. paradoxus is highly conserved when compared to Saccharomyces cerevisiae. In coding regions, the genome of S. paradoxus shares 90% of its identity with the genome of S. cerevisiae , and in the intergenic regions, it has 80% homology [ 102 ]. S. paradoxus is the undomesticated relative of Saccharomyces cerevisiae [ 100 , 103 ]. They co-exist in a similar environment. Saccharomyces paradoxus is almost morphologically indistinguishable from Saccharomyces cerevisiae in nearly all aspects of morphology, metabolism, and its life cycle [ 104 ]. This could be seen by the phylogenetic analysis of yeast isolates using 28S rRNA gene Sanger sequencing, which revealed that these isolates clustered in specific groups, demonstrating their phylogenetic relatedness.

The yeast population in most African fermented cereal foods has also been reported to be dominated by S. cerevisiae. These include mawè [ 14 ], ogi [ 105 ], cereal-based fermented foods [ 4 ], burukutu [ 20 ], and many others [ 4 , 106 ]. In contrast, S. paradoxus has only been reported in a few instances: in akamu , a cereal-based complementary food [ 107 ], and sorghum beer from Ghana and Burkina [ 108 ]. It is noted that in the two instances where the presence of S. paradoxus was reported in the African traditional foods, the authors used molecular characterisation involving sequencing of the internal transcribed spacer regions (ITS1 and ITS2). It is, therefore, possible that in some of the instances where S. cerevisiae has been reported and identification was by phenotypic characterisation based mainly on the fermentation and utilization of different sugars, the yeasts could have been S. paradoxus . This is because they co-exist, share the same phenotypic characteristics and would be identified as S. cerevisiae using the API kit [ 104 ]. It is therefore likely that S. paradoxus plays a greater role in the fermentation of indigenous African fermented foods than has been reported.

The other yeasts found in Hausa koko production in the present work were P. kudriavzevii, C. lusitaniae , and C. tropicalis. P. kudriavzevii is the teleomorph of Candida krusei with a few strains being opportunistic pathogens [ 109 ]. The presence of C. krusei/P. kudriavzevii has been reported extensively in African fermented cereal and other foods including mawe [ 106 ], gowe [ 76 ], and agbelima [ 26 ]. C. lusitaniae and C. tropicalis have been reported in other fermented cereals in Africa. C. lusitaniae in obushera [ 110 ], ogi [ 23 , 106 ], and C. tropicalis in togwa [ 75 ]. Pichia, Candida , Kluyveromyces, Nakaseomyces, Torulaspora, and Cyberlindnera were also among the other genera reported in our previous study on Hausa koko [ 2 ]. Yeasts cause acidification and produce ethanol, carbon dioxide, extracellular enzyme production, as well as generating flavour compounds and bio-preservatives [ 23 , 111 , 112 ].

Most of the LAB and yeast species characterised in the present study in Hausa koko are associated with many other indigenous African fermented foods and play important roles during the process with some deemed as potential probiotic species for starter culture development. It is therefore possible that these LAB and yeast species characterised in this study may also possess such characteristics and hence represent a valuable resource for future study.

The central operation in the processing of millet into Hausa koko is fermentation, which involves the steeping of millet grains and spontaneous fermentation of the steeped grains that have been milled together with spices and made into a slurry. Fermentation in Hausa koko production has been confirmed to be an acidification process that involves the growth of LAB and yeasts, resulting in the lowering of pH. The pH reduced from a range of 6.02 to 6.53 in the grains to 3.51 to 3.99 in the final Hausa koko product . The predominant species of LAB responsible for the souring fermentation identified by whole genome sequencing were Limosilactobacillus pontis, Pediococcus acidilactici , Limosilactobacillus fermentum and Limosilactobacillus reuteri. The yeast species were identified to be Saccharomyces cf. cerevisiae/paradoxus , Saccharomyces cerevisiae, Pichia kudriavzevii , Clavispora lusitaniae , and Candida tropicalis . The lactic acid bacteria Limosilactobacillus pontis and Schleiferilactobacillus harbinensis and the yeast Saccharomyces paradoxus were found to be involved in the fermentation of millet during Hausa koko production in Ghana for the first time.

Food safety and security are major issues, particularly in low medium income countries. Fermented cereals are popular, cheap, sustainable and locally produced and form an important part of the diet in Africa, especially during weaning. The common presence of food-borne pathogens and mycotoxins, and the low content of essential nutrients, are key areas for improvement. Understanding the fermentation process will highlight stages for improvement or intervention, while the identification of key microbes can lead to the development of effective starter cultures to improve the safety and nutritional value of these foods. Fermented foods also provide both a potential source of novel microorganisms with unexplored gene functions and an opportunity to study microbial interactions within a complex changing microbiome. This study provided information about the predominant LAB and yeast populations in Hausa koko production and how they change during the fermentation process. The fully sequenced bacterial isolates and characterised yeasts can be used in future studies for controlled fermentation and the development of safer starter cultures, while functional analysis of the bacterial genomes may identify key functions of fermenting microbes. In addition, an understanding of the dynamic changes during the fermentation process can identify the best stages for starter culture addition or nutritional interventions.

Availability of data and materials

Data are available in the NCBI database: Accession Numbers for the yeast sequences are OR186448-OR186505 while bacterial genomes can be found under BioProject with accession number PRJNA932444.

De Valdez GF, Gerez CL, Torino MI, Rollán G. New trends in cereal-based products using lactic acid bacteria. In: Biotechnology of Lactic Acid Bacteria. : Novel Applications. Oxford, UK: Blackwell Publishing; 2010:273–287.

Atter A, Diaz M, Tano-Debrah K, Kunadu APH, Mayer MJ, Colquhoun IJ, et al. Microbial Diversity and Metabolite Profile of Fermenting Millet in the Production of Hausa koko, a Ghanaian Fermented Cereal Porridge. Front Microbiol. 2021;12:1–15. https://doi.org/10.3389/fmicb.2021.681983 .

Tamang JP, Shin DH, Jung SJ, Chae SW. Functional properties of microorganisms in fermented foods. Front Microbiol. 2016;7:1–13. https://doi.org/10.3389/fmicb.2016.00578 .

Achi OK, Ukwuru M. Cereal-Based Fermented Foods of Africa as Functional Foods. Int J Microbiol Appl. 2015;2:1527–58. https://doi.org/10.1007/978-3-319-78030-6_31 .

Article Google Scholar

Corsetti A, Settanni L. Lactobacilli in sourdough fermentation. Food Res Int. 2007;40:539–58. https://doi.org/10.1016/j.foodres.2006.11.001 .

Article CAS Google Scholar

Charalampopoulos D, Wang R, Pandiella SS, Webb C. Application of cereals and cereal components in functional foods: A review. Int J Food Microbiol. 2002;79:131–41. https://doi.org/10.1016/S0168-1605(02)00187-3 .

Article CAS PubMed Google Scholar

Taylor JRN, Barrion SC, Rooney LW. Functional properties of microorganisms in fermented foods. Front Microbiol. 2010;1:16–9.

Google Scholar

Blandino A, Al-Aseeri ME, Pandiella SS, Cantero D, Webb C. Cereal-based fermented foods and beverages. Food Res Int. 2003;36:527–43. https://doi.org/10.1016/S0963-9969(03)00009-7 .

Jaybhaye RV, Pardeshi IL, Vengaiah PC. Srivastav PP. Processing and technology for millet based food products: a review. J ready to eat food. 2014;1:32–48.

Mani A. Food Preservation by Fermentation and Fermented Food Products. Int J Acad Res Dev. 2018;51–7. https://www.researchgate.net/publication/323200130 .

Ponomarova O, Gabrielli N, Sévin DC, Mülleder M, Zirngibl K, Bulyha K, et al. Yeast creates a niche for symbiotic lactic acid bacteria through nitrogen overflow. Cell Syst. 2017;5:345–357.e6. https://doi.org/10.1016/j.cels.2017.09.002 .

Article CAS PubMed PubMed Central Google Scholar

Kohajdov Z, Karovi J. Kohajdova and Karovicova Fermentation of cereals for specific purpose. 2007;46:51–7

Obafemi YD, Oranusi SU, Ajanaku KO, Akinduti PA, Leech J, Cotter PD. African fermented foods: overview, emerging benefits, and novel approaches to microbiome profiling. npj Sci Food. 2022;6:1–9. https://doi.org/10.1038/s41538-022-00130-w .

Houngbédji M, Johansen P, Padonou SW, Akissoé N, Arneborg N, Nielsen DS, et al. Occurrence of lactic acid bacteria and yeasts at species and strain level during spontaneous fermentation of mawè, a cereal dough produced in West Africa. Food Microbiol. 2018;76:267–78. https://doi.org/10.1016/j.fm.2018.06.005 .

Greppi A, Saubade F, Botta C, Humblot C, Guyot JP, Cocolin L. Potential probiotic Pichia kudriavzevii strains and their ability to enhance folate content of traditional cereal-based African fermented food. Food Microbiol. 2017;62:169–77. https://doi.org/10.1016/j.fm.2007.01.006 .

Assohoun-Djeni NMC, Djeni NT, Messaoudi S, Lhomme E, Koussemon-Camara M, Ouassa T, et al. Biodiversity, dynamics and antimicrobial activity of lactic acid bacteria involved in the fermentation of maize flour for doklu production in Côte d’Ivoire. Food Control. 2016;62:397–404. https://doi.org/10.1016/j.ijfoodmicro.2006.06.006 .

Oguntoyinbo FA, Narbad A. Multifunctional properties of Lactobacillus plantarum strains isolated from fermented cereal foods. J Funct Foods. 2015;17:621–31. https://doi.org/10.1016/j.femsyr.2004.11.002 .

Oguntoyinbo FA, Narbad A. Molecular characterization of lactic acid bacteria and in situ amylase expression during traditional fermentation of cereal foods. Food Microbiol. 2012;31:254–62. https://doi.org/10.1046/j.1365-2672.1997.00227.x .

Annan T, Obodai M, Anyebuno G, Tano-debrah K, Amoa-awua WK. Characterization of the dominant microorganisms responsible for the fermentation of dehulled maize grains into nsiho in Ghana. African J Biotechnol. 2015;14:1640–8. https://doi.org/10.5897/AJB2014.14134 .

Atter A, Obiri-Danso K, Amoa-Awua WK. Microbiological and chemical processes associated with the production of burukutu a traditional beer in Ghana. Int Food Res J. 2014;21:1751–6. https://doi.org/10.1016/j.foodcont.2015.09.037 .

Akabanda F, Owusu-Kwarteng J, Tano-Debrah K, Parkouda C, Jespersen L. The use of lactic acid bacteria starter culture in the production of Nunu, a spontaneously fermented milk product in Ghana. Int J Food Sci. 2014;2014. https://doi.org/10.1155/2014/721067 .

Nyanga LK, Nout MJR, Gadaga TH, Theelen B, Boekhout T, Zwietering MH. Yeasts and lactic acid bacteria microbiota from masau (Ziziphus mauritiana) fruits and their fermented fruit pulp in Zimbabwe. Int J Food Microbiol. 2007;120:159–66. https://doi.org/10.1016/j.ijfoodmicro.2007.06.021 .

Omemu AM, Oyewole OB, Bankole MO. Significance of yeasts in the fermentation of maize for ogi production. Food Microbiol. 2007;24:571–6.

Abriouel H, Omar N Ben, López RL, Martínez-Cañamero M, Keleke S, Gálvez A. Culture-independent analysis of the microbial composition of the African traditional fermented foods poto poto and dégué by using three different DNA extraction methods. Int J Food Microbiol. 2006;111:228–33.

Jespersen L, Nielsen DS, Hønholt S, Jakobsen M. Occurrence and diversity of yeasts involved in fermentation of West African cocoa beans. FEMS Yeast Res. 2005;5:441–53.

Amoa-Awua WK, Frisvad JC, Sefa-Dedeh S, Jakobsen M. The contribution of moulds and yeasts to the fermentation of “agbelima” cassava dough. J Appl Microbiol. 1997;83:288–96.

Atter Amy. Kwame Nkrumah University of Science and Technology Department of Theoretical and Applied Biology College of Science. Microbial and Chemical Processes Associated With Burukutu , a Ghanaian Fermented Alcoholic Beverage. 2012.

Sulmiyati, Said NS, Fahrodi DU, Malaka R, Maruddin F. The Characteristics Yeast Isolated From Commercial Kefir Grain. Hasanuddin J Anim Sci. 2019;1:26–37.

Baker GC, Smith JJ, Cowan DA. Review and re-analysis of domain-specific 16S primers. J Microbiol Methods. 2003;55:541–55.

Kurtzman CP, Robnett CJ. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences Antonie van Leeuwenhoek. Int J Gen Mol Microbiol. 1998;73:331–71. https://doi.org/10.1023/A:1001761008817 .

Owusu-Kwarteng J, Akabanda F, Nielsen DS, Tano-Debrah K, Glover RLK, Jespersen L. Identification of lactic acid bacteria isolated during traditional fura processing in Ghana. Food Microbiol. 2012;32:72–8. https://doi.org/10.1023/A:1001761008817 .

Foster-Nyarko E, Alikhan NF, Ravi A, Thilliez G, Thomson NM, Baker D, et al. Genomic diversity of Escherichia coli isolates from non-human primates in the Gambia. Microb Genomics. 2020;6:1–15. https://doi.org/10.1099/mgen.0.000428 .

Kim D, Song L, Breitwieser FP, Salzberg SL. Centrifuge: Rapid and sensitive classification of metagenomic sequences. Genome Res. 2016;26:1721–9. https://doi.org/10.1099/mgen.0.000428 .

Wick RR, Judd LM, Gorrie CL, Holt KE. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol. 2017;13:1–22. https://doi.org/10.1371/journal.pcbi.1005595 .

Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. Using SPAdes De Novo Assembler. Curr Protoc Bioinforma. 2020;70:1–29. https://doi.org/10.1002/cpbi.102 .

Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, et al. Pilon: An integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS One. 2014;9. https://doi.org/10.1371/journal.pone.0112963 .

Gurevich A, Saveliev V, Vyahhi N, Tesler G. QUAST: Quality assessment tool for genome assemblies. Bioinformatics. 2013;29:1072–5. https://doi.org/10.1093/bioinformatics/btt086 .

Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 2015;25:1043–55. https://doi.org/10.1101/gr.186072.114 .

Nurk S, Meleshko D, Korobeynikov A, Pevzner P. metaSPAdes: a new versatile metagenomics assembler Sergey. 2016.

Kang DD, Li F, Kirton E, Thomas A, Egan R, An H, et al. MetaBAT 2: an adaptive binning algorithm for robust and efficient genome reconstruction from metagenome assemblies. PeerJ. 2019;7:e7359. https://doi.org/10.7717/peerj.7359 .

Article PubMed PubMed Central Google Scholar

Chaumeil P-A, Mussig AJ, Hugenholtz P, Parks DH. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics. 2020;36:1925–7. https://doi.org/10.1093/bioinformatics/btz848 .

Gillespie JJ, Wattam AR, Cammer SA, Gabbard JL, Shukla MP, Dalay O, et al. PATRIC: the comprehensive bacterial bioinformatics resource with a focus on human pathogenic species. Infect Immun. 2011;79:4286–98.

Olson RD, Assaf R, Brettin T, Conrad N, Cucinell C, Davis JJ, et al. Introducing the Bacterial and Viral Bioinformatics Resource Center (BV-BRC): a resource combining PATRIC. IRD and ViPR Nucleic Acids Res. 2023;51:D678–89. https://doi.org/10.1093/nar/gkac1003 .

Wu M, Scott AJ. Phylogenomic analysis of bacterial and archaeal sequences with AMPHORA2. Bioinformatics. 2012;28:1033–4.

Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–7.

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–9.

Stamatakis A. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006;22:2688–90. https://doi.org/10.1093/bioinformatics/btl446 .

Letunic I, Bork P. Interactive tree of life (iTOL) v3: an online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016;44:W242–5. https://doi.org/10.1093/nar/gkw290 .

Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312–3. https://doi.org/10.1093/bioinformatics/btl446 .

Adeleke BS, Ayangbenro AS, Babalola OO. Genomic assessment of Stenotrophomonas indicatrix for improved sunflower plant. Curr Genet. 2021;67:891–907. https://doi.org/10.1007/s00294-021-01199- .

Krishna PS, Sreenivas A, Singh DK, Shivaji S, Prakash JSS. Draft genome sequence of Bacillus okhensis Kh10-101T, a halo-alkali tolerant bacterium from Indian saltpan. Genomics Data. 2015;6:283–4. https://doi.org/10.1016/j.gdata.2015.10.019 .

Atter A. Microbial and Chemical Processes Associated with Burukutu, a Ghanaian Fermented Alcoholic Beverage. MPhil. Thesis, Kwame Nkrumah University of Science and Technology. 2012.

Amoa-Awua WKA, Appoh FE, Jakobsen M. Lactic acid fermentation of cassava dough into agbelima. Int J Food Microbiol. 1996;31:87–98. https://doi.org/10.1016/0168-1605(96)00967-1 .

Sherifah W, Daodu AA. Physiological properties of a microbial community in spontaneous fermentation of maize (Zea mays) for Ogi Production. Int Res J Microbiol. 2011;2:109–15.

Jespersen L. Occurrence and taxonomic characteristics of strains of Saccharomyces cerevisiae predominant in African indigenous fermented foods and beverages. FEMS Yeast Res. 2003;3:191–200. https://doi.org/10.1016/S1567-1356(02)00185-X .

Bansal P, Kumar R, Singh J, Dhanda S. Next generation sequencing, biochemical characterization, metabolic pathway analysis of novel probiotic Pediococcus acidilactici NCDC 252 and it’s evolutionary relationship with other lactic acid bacteria. Mol Biol Rep. 2019;46:5883–95. https://doi.org/10.1007/s11033-019-05022-z .

Lei V, Jakobsen M. Microbiological characterization and probiotic potential of koko and koko sour water, African spontaneously fermented millet porridge and drink. J Appl Microbiol. 2004;96:384–97. https://doi.org/10.1046/j.1365-2672.2004.02162.x .

Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020;70:2782–858. https://doi.org/10.1099/ijsem.0.004107 .

De Vuyst L, Neysens P. The sourdough microflora: Biodiversity and metabolic interactions. Trends Food Sci Technol. 2005;16:43–56. https://doi.org/10.1016/j.tifs.2004.02.012 .

Vogelmann SA, Seitter M, Singer U, Brandt MJ, Hertel C. Adaptability of lactic acid bacteria and yeasts to sourdoughs prepared from cereals, pseudocereals and cassava and use of competitive strains as starters. Int J Food Microbiol. 2009;130:205–12. https://doi.org/10.1016/j.ijfoodmicro.2009.01.020 .

Kebede A. Isolation, characterization and identification of lactic acid bacteria involved in traditional fermentation of borde, an Ethiopian cereal beverage. African J Biotechnol. 2007;6:1469–78.

Nieminen MT, Novak-Frazer L, Collins R, Dawsey SP, Dawsey SM, Abnet CC, et al. Alcohol and acetaldehyde in African fermented milk mursik - A possible etiologic factor for high incidence of esophageal cancer in Western Kenya. Cancer Epidemiol Biomarkers Prev. 2013;22:69–75. https://doi.org/10.1158/1055-9965.EPI-12-0908 .

Bensid A, El Abed N, Houicher A, Regenstein JM, Özogul F. Antioxidant and antimicrobial preservatives: Properties, mechanism of action and applications in food–a review. Crit Rev Food Sci Nutr. 2022;62:2985–3001. https://doi.org/10.1080/10408398.2020.1862046 .

Basu Thakur P, Long AR, Nelson BJ, Kumar R, Rosenberg AF, Gray MJ. Complex Responses to Hydrogen Peroxide and Hypochlorous Acid by the Probiotic Bacterium Lactobacillus reuteri. mSystems. 2019;4:1–17. https://doi.org/10.1128/mSystems.00453-19 .

Mu Q, Tavella VJ, Luo XM. Role of Lactobacillus reuteri in human health and diseases. Front Microbiol. 2018;9 APR:1–17. https://doi.org/10.3389/fmicb.2018.00757 .

Whitehead K, Versalovic J, Roos S, Britton RA. Genomic and genetic characterization of the bile stress response of probiotic Lactobacillus reuteri ATCC 55730. Appl Environ Microbiol. 2008;74:1812–9. https://doi.org/10.1128/AEM.02259-07 .

Hammes WP, Hertel C. The Genera Lactobacillus and Carnobacterium. In: The Prokaryotes. New York, NY: Springer US; 2006. p. 320–403. https://doi.org/10.1007/0-387-30744-3_10 .

Walter J, Britton RA, Roos S. Host-microbial symbiosis in the vertebrate gastrointestinal tract and the Lactobacillus reuteri paradigm. Proc Natl Acad Sci U S A. 2011;108(SUPPL. 1):4645–52. https://doi.org/10.1073/pnas.1000099107 .

Article PubMed Google Scholar

Ferguson RMW, Merrifield DL, Harper GM, Rawling MD, Mustafa S, Picchietti S, et al. The effect of Pediococcus acidilactici on the gut microbiota and immune status of on-growing red tilapia (Oreochromis niloticus). J Appl Microbiol. 2010;109:851–62.

Carafa I, Nardin T, Larcher R, Viola R, Tuohy K, Franciosi E. Identification and characterization of wild lactobacilli and pediococci from spontaneously fermented Mountain Cheese. Food Microbiol. 2015;48:123–32. https://doi.org/10.1016/j.fm.2014.12.003 .

Mohamed A, Ibrahim M, Abdou M, Mohammed A. Effect of Pediococcus Acidilactici and Its Bacteriocin on Soft Cheese Quality and Validity. 2013.

Ammor MS, Mayo B. Selection criteria for lactic acid bacteria to be used as functional starter cultures in dry sausage production: An update. Meat Sci. 2007;76:138–46. https://doi.org/10.1016/j.meatsci.2006.10.022 .

Barros RR, Carvalho MDGS, Peralta JM, Facklam RR, Teixeira LM. Phenotypic and genotypic characterization of Pediococcus strains isolated from human clinical sources. J Clin Microbiol. 2001;39:1241–6. https://doi.org/10.1128/JCM.39.4.1241-1246.2001 .

Adimpong DB, Nielsen DS, Sørensen KI, Derkx PMF, Jespersen L. Genotypic characterization and safety assessment of lactic acid bacteria from indigenous African fermented food products. BMC Microbiol. 2012;12:10–2. https://doi.org/10.1186/1471-2180-12-75 .

Mugula JK, Nnko SAM, Narvhus JA, Sørhaug T. Microbiological and fermentation characteristics of togwa, a Tanzanian fermented food. Int J Food Microbiol. 2003;80:187–99. https://doi.org/10.1016/S0168-1605(02)00141-1 .

Vieira-Dalodé G, Jespersen L, Hounhouigan J, Moller PL, Nago CM, Jakobsen M. Lactic acid bacteria and yeasts associated with gowé production from sorghum in Bénin. J Appl Microbiol. 2007;103:342–9. https://doi.org/10.1111/j.1365-2672.2006.03252.x .

Starkutė V, Krunglevičiūtė V, Bartkienė E, Bartkevičs V, Žadeikė D, Juodeikienė G. Cereal by - products conversion to stock with high content of p. Acidilactici by using enzymatic treatment combined with solid state and submerged fermentation. Foodbalt 2017 : 11th Baltic Conference on Food Science and Technology “Food science and technology in a changing world”, Jelgava, April 27–28, 2017 : abstract book / Latvia University of Agriculture Faculty of Food Technology. S.l. : s.n., 2017, 2017. 2017.

Sekwati-Monang B, Gänzle MG. Microbiological and chemical characterisation of ting, a sorghum-based sourdough product from Botswana. Int J Food Microbiol. 2011;150:115–21. https://doi.org/10.1016/j.ijfoodmicro.2012.09.013 .

Sekwati-Monang B. Microbiological and Chemical Characteristics of Ting, a Sorghum-based Gluten-Free Fermented Cereal Product from Botswana. University of Alberta; 2011.

Omemu AM, Faniran OW. Assessment of the antimicrobial activity of lactic acid bacteria isolated from two fermented maize products-ogi and kunnu-zaki. Malays J Microbiol. 2011;7:124–8.

CAS Google Scholar

Agarry OO, Nkama I, Akoma O. Production of Kunun-zaki (A Nigerian fermented cereal beverage) using starter culture. Int Res J Microbiol. 2010;1:18–25. http://www.interesjournals.org/IRJM .

Pswarayi F, Gänzle MG. Composition and origin of the fermentation microbiota of mahewu, a Zimbabwean fermented cereal beverage. Appl Environ Microbiol. 2019;85. https://doi.org/10.1128/AEM.03130-18 .

Sawadogo-Lingani H, Lei V, Diawara B, Nielsen DS, Møller PL, Traoré AS, et al. The biodiversity of predominant lactic acid bacteria in dolo and pito wort for the production of sorghum beer. J Appl Microbiol. 2007;103:765–77. https://doi.org/10.1111/j.1365-2672.2007.03306.x .

Dalié D, Pinson-Gadais L, Atanasova-Penichon V, Marchegay G, Barreau C, Deschamps A, et al. Impact of Pediococcus pentosaceus strain L006 and its metabolites on fumonisin biosynthesis by Fusarium verticillioides. Food Control. 2012;23:405–11. https://doi.org/10.1016/j.foodcont.2011.08.008 .

Gupta VK, Sharma B. Role of Phytochemicals in Neurotrophins Mediated Regulation of Alzheimer’s Disease. Int J Complement Altern Med. 2017;7. https://doi.org/10.15406/ijcam.2017.07.00231 https://doi.org/10.15406/ijcam.2017.07.00231 .

Beyatli Y, Gunduz U, Osmanagaoglou O. Isolation and characterization of pediocin producing Pediococcus pentosaceus Pep1 from vacuum-packed sausages. Turk J Biol. 2001;25:133–43. http://journals.tubitak.gov.tr/biology/issues/biy-01-25-2/biy-25-2-4-9910-5.pdf .

Ouattara CAT, Somda MK, Moyen R, Traore SA. Isolation and identification of lactic acid and non-acid lactic bacteria from dgu of Western Africa traditional fermented millet-based food. African J Microbiol Res. 2015;9:2001–5. https://doi.org/10.5897/AJMR2015.7548 .

Oh YJ, Jung DS. Evaluation of probiotic properties of Lactobacillus and Pediococcus strains isolated from Omegisool, a traditionally fermented milletalcoholic beverage in Korea. Lwt. 2015;63:437–44. https://doi.org/10.1016/j.lwt.2015.03.005 .

Fusco V, Quero GM, Cho G-S, Kabisch J, Meske D, Neve H, et al. The genus Weissella: taxonomy, ecology and biotechnological potential. Front Microbiol. 2015;6. https://doi.org/10.3389/fmicb.2015.00155 .

Lee SH, Min KJ. Phytochemicals. In: Encyclopedia of Biomedical Gerontology. 2019;35–47. https://doi.org/10.1016/j.anaerobe.2011.12.015

Valerio F, Favilla M, De Bellis P, Sisto A, de Candia S, Lavermicocca P. Antifungal activity of strains of lactic acid bacteria isolated from a semolina ecosystem against Penicillium roqueforti, Aspergillus niger and Endomyces fibuliger contaminating bakery products. Syst Appl Microbiol. 2009;32:438–48. https://doi.org/10.1016/j.syapm.2009.01.004 .

Nam H, Ha M, Lee E, Lee Y. Effect of Enterococcus faecalis strain PL9003 on adherence and growth of Helicobacter pylori. J Microbiol Biotechnol. 2002;12:746–52. https://doi.org/10.1128/AEM.68.9.4642 .

Njeru P, Rösch N, Ghadimi D, Geis A, Bockelmann W, de Vrese M, et al. Identification and characterisation of lactobacilli isolated from Kimere, a spontaneously fermented pearl millet dough from Mbeere, Kenya (East Africa). Benef Microbes. 2010;1:243–52. https://doi.org/10.3920/BM2010.0019 .

Muyanja CMBK, Narvhus JA, Treimo J, Langsrud T. Isolation, characterisation and identification of lactic acid bacteria from bushera: A Ugandan traditional fermented beverage. Int J Food Microbiol. 2003;80:201–10. https://doi.org/10.1016/S0168-1605(02)00148-4 .

Torriani S, Felis GE, Dellaglio F. Differentiation of Lactobacillus plantarum, L. pentosus, and L. paraplantarum by recA Gene Sequence Analysis and Multiplex PCR Assay with recA Gene-Derived Primers. Appl Environ Microbiol. 2001;67:3450–4. https://doi.org/10.1128/AEM.67.8.3450-3454.2001 .

Nwachukwu E, Achi OK, Ijeoma IO. Lactic acid bacteria in fermentation of cereals for the production of indigenous Nigerian foods. African J Food Sci Technol. 2010;1:21–026. https://doi.org/10.1128/AEM.67.8.3450-3454.2001 .

Sekwati-Monang B, Valcheva R, Gänzle MG. Microbial ecology of sorghum sourdoughs: Effect of substrate supply and phenolic compounds on composition of fermentation microbiota. Int J Food Microbiol. 2012;159:240–6. https://doi.org/10.1016/j.ijfoodmicro.2012.09.013 .

Agostini C, Eckert C, Vincenzi A, Machado BL, Jordon BC, Kipper JP, et al. Characterization of technological and probiotic properties of indigenous Lactobacillus spp. from south Brazil. 3 Biotech. 2018;8:1–12. https://doi.org/10.1007/s13205-018-1469-7 .

Holzapfel WH. Appropriate starter culture technologies for small-scale fermentation in developing countries. Int J Food Microbiol. 2002;75:197–212. https://doi.org/10.1016/S0168-1605(01)00707-3 .

Kowallik V, Miller E, Greig D. The interaction of Saccharomyces paradoxus with its natural competitors on oak bark. Mol Ecol. 2015;24:1596–610. https://doi.org/10.1111/mec.13120 .

Fay JC, Benavides JA. Evidence for domesticated and wild populations of saccharomyces cerevisiae. PLoS Genet. 2005;1:0066–71. https://doi.org/10.1371/journal.pgen.0010005 .

Kellis M, Patterson N, Endrizzi M, Birren B, Lander ES. Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature. 2003;423:241–54. https://doi.org/10.1038/nature01644 .

Tsai IJ, Bensasson D, Burt A, Koufopanou V. Population genomics of the wild yeast Saccharomyces paradoxus: Quantifying the life cycle. Proc Natl Acad Sci U S A. 2008;105:4957–62. https://doi.org/10.1073/pnas.0707314105 .

Sniegowski PD, Dombrowski PG, Fingerman E. Saccharomyces cerevisiae and Saccharomyces paradoxus coexist in a natural woodland site in North America and display different levels of reproductive isolation from European conspecifics. FEMS Yeast Res. 2002;1:299–306. https://doi.org/10.1016/S1567-1356(01)00043-5 .

Kigigha LT, Chibueze Izah S, Peace Okowa I. Microbial Characterization of Maize Fermentation Water during Ogi Production. J Environnemental Treat Tech. 2016;4:41–5. http://www.jett.dormaj.com .

Greppi A, Rantsiou K, Padonou W, Hounhouigan J, Jespersen L, Jakobsen M, et al. Determination of yeast diversity in ogi, mawè, gowé and tchoukoutou by using culture-dependent and -independent methods. Int J Food Microbiol. 2013;165:84–8. https://doi.org/10.1016/j.ijfoodmicro.2013.05.005 .

Obinna-Echem PC, Kuri V, Beal J. Evaluation of the microbial community, acidity and proximate composition of akamu, a fermented maize food. J Sci Food Agric. 2014;94:331–40. https://doi.org/10.1002/jsfa.6264 .

Naumova ES, Korshunova IV, Jespersen L, Naumov GI. Molecular genetic identification of Saccharomyces sensu stricto strains from African sorghum beer. FEMS Yeast Res. 2003;3:177–84. https://doi.org/10.1016/S1567-1356(02)00191-5 .

Johansen PG, Owusu-Kwarteng J, Parkouda C, Padonou SW, Jespersen L. Occurrence and Importance of Yeasts in Indigenous Fermented Food and Beverages Produced in Sub-Saharan Africa. Front Microbiol. 2019;10. https://doi.org/10.3389/fmicb.2019.01789 .

Mukisa IM, Porcellato D, Byaruhanga YB, Muyanja CMBK, Rudi K, Langsrud T, et al. The dominant microbial community associated with fermentation of Obushera (sorghum and millet beverages) determined by culture-dependent and culture-independent methods. Int J Food Microbiol. 2012;160:1–10. https://doi.org/10.1016/j.ijfoodmicro.2012.09.023 .

Furukawa S, Watanabe T, Toyama H, Morinaga Y. Significance of microbial symbiotic coexistence in traditional fermentation. J Biosci Bioeng. 2013;116:533–9. https://doi.org/10.1016/j.jbiosc.2013.05.017 .

Amoa-Awua WK, Sampson E, Tano-Debrah K. Growth of yeasts, lactic and acetic acid bacteria in palm wine during tapping and fermentation from felled oil palm (Elaeis guineensis) in Ghana. J Appl Microbiol. 2007;102:599–606. https://doi.org/10.1111/j.1365-2672.2006.03074.x .

Download references

Acknowledgements

The authors acknowledge the participation of all Hausa koko processors who were involved in the study.

This work was funded by the UK Biotechnology and Biological Sciences Research Council (BBSRC) via a Global Challenges Research Fund Data and Resources award and Institute Strategic Programmes for Food Innovation and Health (BB/R012512/1 Themes 1 BBS/E/F/000PR10343 and 3 BBS/E/F/000PR10346) and Gut Microbes and Health (BB/R012490/1 Theme 3 BBS/E/F/000PR10356).

Author information

Authors and affiliations.

Food Microbiology and Mushroom Research Division, CSIR-Food Research Institute, Accra, Ghana

Amy Atter & Wisdom Amoa-Awua

Department of Nutrition and Food Science, University of Ghana, Accra, Ghana

Amy Atter, Kwaku Tano-Debrah & Angela Parry-Hanson Kunadu

Food and Health Institute Strategic Programme, Quadram Institute Bioscience, Norwich Research Park, Norwich, UK

Amy Atter, Maria Diaz & Arjan Narbad

Gut Microbes and Health Institute Strategic Programme, Quadram Institute Bioscience, Norwich Research Park, Norwich, UK

Melinda J. Mayer, Lizbeth Sayavedra & Arjan Narbad

Department of Biochemistry, Cell and Molecular Biology, University of Ghana, Accra, Ghana

Collins Misita

Department of Agro-Processing Technology and Food Bio-Sciences, CSIR College of Science and Technology, Accra, Ghana

Wisdom Amoa-Awua

You can also search for this author in PubMed Google Scholar

Contributions

AA collected the samples, performed the microbial analysis, DNA extraction for profiling and sequencing, interpreted the data, drafted the original manuscript and edited it. MD, KT-D, AP-HK, MJM, WA-A, and AN supervised the work, edited, and approved the manuscript. LS recovered MAGs and constructed the phylogenomic tree for LAB and CM constructed the phylogenomic tree for yeast isolates. All authors edited and approved the manuscript.

Corresponding author

Correspondence to Amy Atter .

Ethics declarations

Ethics approval and consent to participate.

The consent of research participants/ Hausa koko processors was sought by informing them about the research and its benefits. The research did not collect any personal information from participants, but all were given a comprehensive explanation of the entire procedure. There was absolutely no risk and participants were allowed to opt out at any point. Additionally, processors did not suffer any consequences as a result of the data acquired. This study was approved by the Ethics Committee for Basic and Applied Sciences (ECBAS), University of Ghana with certified Protocol Number ECBAS 014/19–20.

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Atter, A., Diaz, M., Tano-Debrah, K. et al. The predominant lactic acid bacteria and yeasts involved in the spontaneous fermentation of millet during the production of the traditional porridge Hausa koko in Ghana. BMC Microbiol 24 , 163 (2024). https://doi.org/10.1186/s12866-024-03317-1

Download citation

Received : 21 July 2023

Accepted : 03 May 2024

Published : 14 May 2024

DOI : https://doi.org/10.1186/s12866-024-03317-1

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

Lactic acid bacteria
Fermented millet
Whole genome sequencing (WGS)

BMC Microbiology

ISSN: 1471-2180

General enquiries: [email protected]

IMAGES

21 Essential Hausa Phrases You'll Need in Nigeria
Hausa People: Language, Tribe and Culture
Hausa
Hausa language, alphabets and pronunciation
Basic Hausa Language
Hausa language

VIDEO

Cikakken Tarihin Mahatma Gandhi 🇮🇳
Knowing the Hausa tribe of Africa in 30 sec
ያሉት ሁሉ የተፈፀሙላት ትንቢተኛዋ ሴት ስለወደፊት የተነበዩት አስፈሪ ትንቢት
Lesson 2 Hausa Language for Beginners / Koyan Turanci a Saukake
Hausa Language Beginner's Guide
(hausa movie song) sanafahana remix

COMMENTS

Hausa Language and Culture Acquisitions at Columbia: Biography, Culture
Hausa Language and Culture Acquisitions at Columbia: Biography, Culture, History, Proverbs, Religion, and Society ... [A pamphlet on the religious & social meaning of the hijab.] Kure, Mai Kudi. Shaida bishara ga Musulmi Hausawa da Fulani musamman ... [1999] (156 p.) [In Hausa, a biography of Usman dan Fodio, & on the political history of major ...
A History of the Hausa Language
Written by the world's leading expert on Hausa, this ground-breaking book is a synthesis of his life's work, and provides a lucid and comprehensive history of the language. It describes Hausa as it existed in former times and sets out subsequent changes in phonology, including tonology, morphology, grammar, and lexicon.
Hausa language
Hausa (/ ˈ h aʊ s ə /; Harshen / Halshen Hausa listen ⓘ; Ajami: هَرْشٜىٰن هَوْسَا) is a Chadic language that is spoken by the Hausa people in the northern parts of Nigeria, Ghana, Cameroon, Benin and Togo, and the southern parts of Niger, and Chad, with significant minorities in Ivory Coast.A small number of speakers also exist in Sudan.. Hausa is a member of the ...
Hausa language
Hausa has long been written using a modified Arabic alphabet called ajami.Since about 1912, Hausa has also been written in a standardized orthography called boko, originally meaning "sham" or "deceit," that is based on the Latin alphabet (with the addition of modified letters that represent glottalized consonants).This Latin-based orthography is the one now used for education ...
Hausa
Hausa, people found chiefly in northwestern Nigeria and adjacent southern Niger.They constitute the largest ethnic group in the area, which also contains another large group, the Fulani, perhaps one-half of whom are settled among the Hausa as a ruling class, having adopted the Hausa language and culture.The language belongs to the Chadic group of the Afro-Asiatic (formerly Hamito-Semitic ...
The Hausa Language (Chapter 1)
Hausa employs two writing systems dating from the beginning of the twentieth century, one using the Latin alphabet (called boko), the other using the Arabic alphabet (called ajami). Hausa linguistic scholarship over the past century and a half is outlined, including that of Hausa-speaking linguists in Nigeria and Niger in recent times.
Dictionary of the Hausa Language
Hausa is an African language originating in Niger and northern Nigeria and spoken widely in West and Central Africa as a lingua franca. Charles Henry Robinson (1861-1925) was the first student of the short-lived Hausa Association, formed in 1891 to promote the study of the Hausa Language and people. The Association sponsored Robinson to stay ...
The Hausa Language
The Hausa Language. Hausa is classified as a member of the Chadic branch of the Afro-Asiatic family of languages. It is the best known and most important member of the Chadic branch. It is the most widely used in the fields of education and it lays claim to a significant literatures. By way of number, it is spoken by an estimated 40 to 50 ...
HausaDictionary.com
HausaDictionary.com is an online bilingual dictionary that aims to offer the most useful and accurate Hausa to English or English to Hausa translations and definitions. This site contains a wide range of Hausa and English language materials and resources to help you learn Hausa or English. Pick up some basic terms and phrases here, expand your ...
Hausa Dictionary Online Translation LEXILOGOS
Hausa language. → Hausa keyboard to type a text with the special characters of the Boko script. • Teach yourself Hausa: Hausa course. • Hausa basic course, Foreign service institute (1963) (+ audio) • Hausa online Lehrbuch: Hausa course, by Franz Stoiber (2002) • Hausa by Al-Amin Abu-Manga, in Encyclopedia of Arabic language and ...
Welcome To The Hausa Language: A Beginner's Guide And Language
Conclusion. Learning the Hausa language is a rewarding journey that allows you to connect with the vibrant Hausa community and explore the rich culture and history of West Africa. By starting with basic phrases, understanding grammar rules, and utilizing various language resources, you'll develop the skills to communicate effectively in Hausa.
Hausa Language and Literature
Hausa is one of the most widely spoken languages in West Africa, as noted in Kenneth Katzner's The Languages of the World (London: Routledge, 2011). Further, Philip J. Jaggar, the author of "Chadic Languages," published in the Concise Encyclopedia of Languages of the World (Oxford: Elsevier, 2009), notes that with upward of over thirty ...
Hausa language summary
Hausa language, Afro-Asiatic language of northern Nigeria and southern Niger. Hausa, which is spoken by some 40-50 million people, belongs to the Chadic branch of the Afro-Asiatic language phylum. Outside of Hausaland, communities of Hausa merchants have stimulated the use of Hausa as a lingua franca across a broad area of the African Sahel and savanna region.
Hausa language, alphabets and pronunciation
Hausa is an officially recognised language and is used in education and trade. Hausa is also an official language in Ghana, where there are about 565,000 speakers. Other countries with significant numbers of Hausa speakers include Benin (1 million), Sudan (740,000), Chad (398,000), Côte d'Ivoire (395,000) and Cameroon (312,500) .
Hausa people
The Hausa (autonyms for singular: Bahaushe (), Bahaushiya (); plural: Hausawa and general: Hausa; exonyms: Ausa; Ajami: مُتَنٜىٰنْ هَوْسَا / هَوْسَاوَا; Tyap: A̱kpat) are a native ethnic group in West Africa. They speak the Hausa language, which is the second most spoken language after Arabic in the Afro-Asiatic language family. ...
Hausa Language
Hausa is a widely spoken language in West Africa, with an estimated 25 million speakers in the region. It is an Afro-Asiatic language and is closely related to the Fula language. The language is written in the Arabic script and has its own orthography called ajami. It is a subject-object-verb language, with a system of noun classes and verb ...
Discovering The Hausa Tribe: Origins, Language, And Cultural
The Hausa tribe, originating from the ancient Borno Empire, is a vibrant and significant ethnic group in West Africa. While not indigenous to Ghana, Hausa communities can be found in various regions of the country. The Hausa language, closely associated with Islam, serves as a means of communication for millions of people in Nigeria and ...
Hausa Language: Meaning and translation of Hausa words, names, proverbs
English: Allah yasa hakan shine mafi Alkhairi. HalimaModibbo . Translations (1) . Add Translation. medeakran. Hausa: A USA , 3 Najeriya Siblings kammala karatu kamar yadda likitoci a wannan rana; Yana da sau uku daraja kamar yadda 'ya'ya uku daga wannan.
Full List: Hausa Is World's 11th Most Spoken Language
Share. 2 Min Read. New research has found that the Hausa language, which is widely spoken in Northern Nigeria and other African nations, is the world's 11th most spoken language. Hausa language, the most important indigenous lingua franca in West and Central Africa, spoken as a first or second language by about 40-50 million people.
21 native Hausa words and phrases and their meaning in English
Hausa people predominantly occupy the northern half of Nigeria. They speak the Hausa language. This Afroasiatic language is influenced by Arabic because a significant population of people from this ethnic group are Muslims. If you interact with people from this community, you should know some Hausa words to facilitate communication with them.
Hausa Language: 4 interesting things you should know about Nigeria's
Hausa is arguably one of the most advanced languages in Nigeria, and Africa as a whole. The language was commonly written with a variant of the Arabic script known as ajami but is now written with ...
Phonology (Chapter 2)
Summary. The chapter begins with an overview of current Hausa phonology. It then provides a picture of what existed in 'Old Hausa' and the subsequent changes that took place, many due to regular sound laws such as Klingenheben's Law, the Law of Codas in Reduplication, loss of word-final nasals, and the change of non-initial /r/ into /y/.
Hausa Man Hawking in the East Speaks Igbo Fluently to People, Video
A video of a Hausa hawker speaking the Igbo language fluently has gone viral and amazed Igbo people. The Hausa hawker interacted with the Igbo woman like an Easterner to the point that men shook his hands in admiration. Mixed reactions trailed the video as people discussed the major tribes in Nigeria and the challenges of learning the languages.
Nigerian creates new Hausa language script
Yusuf Zakariya Alkanawi created a new script for the Hausa language after discovering that the original had disappeared following centuries of interaction with Arabic and Latin scripts. The ...
The Top 50 Languages Spoken in Africa
Hausa is written in both the Arabic script and the Latin alphabet. However, the Latin alphabet, called Boko, tends to be the main script used these days among Hausa speakers. Hausa is a tonal language, but don't let that put you off. Each of the five vowels (a, e, i, o, u) can either have a high or low pitch, so they're really more like 10 ...
Hausa language
Tags: Language. Hausa (/ˈhaʊsə/) (Yaren Hausa or Harshen Hausa) is the Chadic language (a branch of the Afro-Asiatic language family) with the largest number of speakers spoken as a first language by about 34 million people and as a second language by about 18 million more an approximate total of 52 million people.
The predominant lactic acid bacteria and yeasts involved in the
Spontaneous fermentation of cereals like millet involves a diverse population of microbes from various sources, including raw materials, processing equipment, fermenting receptacles, and the environment. Here, we present data on the predominant microbial species and their succession at each stage of the Hausa koko production process from five regions of Ghana. The isolates were enumerated ...